Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xl3.1-xlk70c04ex.3                         13 END     1          11        7                PR domain containing 1, with ZNF domain [Xenopus laevis]
     2   1.0    0Xl3.1-xlk147n15ex.3                        10 END     2          22       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-xlk70c04ex.3                         13 PI      92        107     1043                PR domain containing 1, with ZNF domain [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012779283 Xl3.1-XL161m14.3 - 9 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL161m14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTACAGAAGCACTTTTTGGTACACACAGGGGAGAAGCCTCATGAATGTCAGGTTTGTCATAAACGGTTCAGCAGCACAAGCAATCTTAAGACCCACTTACGACTGCACTCTGGAGAGAAGCCCTACCAGTGCAAACTTTGTCCTGCAAAGTTTACTCAATTTGTTCATCTCAAACTGCACAAACGCCTTCACACAAGAGAGAGACCACACAAATGCATTCATTGCCACAAGAGCTACATCCACCTGTGCAGCCTCAACTTCCACATGAAAGGCAATTGCCCTGTATCTCCAAGACTGGGTTTGTCTATGGAGGATCTGAATCGAATCAATGACGAAATTGAAAAGTTTGACATCAGTGACAGTGCAGACCAGTTAGATGATATGGAAGATATGGACATGTCTCCTGCTGTGGAGAAAGAAATAATGACTCTTCTCAGGAGAGAGATAGATGAATCAAGCATGAAAGTGTCTGTCTCAAGGAATATGGGCAATGGACTTATCACATCCGGATGCAACTTTTATGACCGATCTGATGCAATAGTAATGAAGTTGCCTCATAGCTCTCCACTACCTCTGTTACCTGTAAAGGTCAAACAAGAATCCTTTGATCAAATGGACTCTTAACAGAAAGAAGAATTAAGTGTTATTTATGGGGTCAGGATACTCTTAGCAATTATTTGTATATATTTATGTAGCTATGTCATTGTGTTGGCCTGGGGAGGTAAAACTCTCTAAGAGCCCTATTTGAAAAGAAGGATCTCCGAGATAACTATTCTCAGGGCATGGAAAAAGGCAGGGAAATGTGTGTATTGCCTACTCACTTATTAATTCTATCACTGAAAGACAATCATTTATCCATAATTATATGTCATTGAAATTATTTCATAATTTATTATGCAATTTATCATACTTAAAGCAATAATTATCAAATGTTTACAATGAGGGGAAAAAATCATTGTAATTTCAATCTATATATATATACAGTATATATTTATGTATATATGTTTCATGTGGCCATTTATGTAGATATTTTCTGCACATATAAGTTACAAAAGAAAAAAAGAAACAACAGAAAACCTAAGATTTGACAAGTATTTATAGGATCTGCATACCAAATGAACAATTTTTGTTGCCAAAGCTGCACATTAGACTTGTTGGATCCGTAGCTTTTTTT
                                                  Xl3.1-CHK-1012697328                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAAGCACTTTTTGGTACACACAGGGGAGAAGCCTCATGAATGTCAGGTTTGTCATAAACGGTTCAGCAGCACAAGCAATCTTAAGACCCACTTACGACTGCACTCTGGAGAGAAGCCCTACCAGTGCAAACTTTGTCCTGCAAAGTTTACTCAATTTGTTCATCTCAAACTGCACAAACGCCTTCACACAAGAGAGAGACCACACAAATGCATTCATTGCCACAAGAGCTACATCCACCTGTGCAGCCTCAACTTCCACATGAAAGGCAATTGCCCTGTATCTCCAAGACTGGGTTTGTCTATGGAGGATCTGAATCGAATCAATGACGAAATTGAAAAGTTTGACATCAGTGACAGTGCAGACCAGTTAGATGATATGGAAGATATGGACATGTCTCCTGCTGTGGAGAAAGAAATAATGACTCTTCTCAGGAGAGAGATAGATGAATCAAGCATGAAAGTGTCTGTCTCAAGGAATATGGGCAATGGACTTATCACATCCGGATGCAACTTTTATGACCGATCTGATGCAATAGTAATGAAGTTGCCTCATAGCTCTCCACTACCTCTGTTACCTGTAAAGGTCAAACAAGAATCCTTTGATCAAATGGACTCTTAACAGAAAGAAGAATTAAGTGTTATTTATGGGGTCAGGATACTCTTAGCAATTATTTGTATATATTTATGTAGCTATGTCATTGTGTTGGCCTGGGGAGGTAAAACTCTCTAAGAGCCCTATTTGAAAAGAAGGATCTCCGAGATAACTATTCTCAGGGCATGGAAAAAGGCAGGGAAATGTGTGTATTGCCTACTCACTTATTAATTCTATCACTGAAAGACAATCATTTATCCATAATTATATGTCATTGAAATTATTTCATAATTTATTATGCAATTTATCATACTTAAAGCAATAATTATCAAATGTTTACAATGAGGGGAAAAAATCATTGTAATTTCAATCTATATATATATACAGTATATATTTATGTATATATGTTTCATGTGGCCATTTATGTAGATATTTTCTGCACATATAAGTTACAAAAGAAAAAAAGAAACAACAGAAAACCTAAGATTTGACAAGTATTTATAGGATCTGCATACCAAATGAACAATTTTTGTTGCCAAAGCTGCACATTAGACTTGTTGGATCCGTAGCTTTTTTTTTTTTN
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 2e-023     NP_001071858.1 zinc finger protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 7e-023     NP_001012948.1 B-cell lymphoma 6 protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bt ---- 7e-023     XP_001256593.1 PREDICTED: similar to zinc finger protein 211 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PREDICTED - Xt ---- 3e-023     NP_001120358.1 hypothetical protein LOC100145431 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sp ---- 4e-026     NP_001073021.1 Blimp1/Krox1b [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 1e-034     NP_492723.1 Drosophila ODD-skipped-like ODD-3 (odd-3) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 6e-036     NP_647982.1 CG5249-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 3e-036     XP_316619.4 AGAP006592-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 3e-072     NP_955809.2 Blimp-1 homolog [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 8e-090     XP_618588.4 PREDICTED: similar to PR domain containing 1, with ZNF domain [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-090     NP_001189.2 PR domain containing 1, with ZNF domain isoform 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 3e-094     XP_539068.2 PREDICTED: similar to PR-domain zinc finger protein 1 (Beta-interferon gene positive-regulatory domain I binding factor) (BLIMP-1) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-094     NP_031574.2 PR domain containing 1, with ZNF domain [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 6e-121     NP_001080573.1 PR domain containing 1, with ZNF domain [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL161m14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------------------ATG------------------------------------------------------------------------ATG------ATG---ATG------------------------ATG---------------------------------ATG---------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------ATG------TAA------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------TAA---------TGA------------------TAA------------------------TAA------ATG------------------------------------------TGA---------------------------------------------------ATG------------ATG---------ATGTAG------------------------------------------------------------------------TAG---------------TGA---------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                              ]
  5   1   0       add Ga15      out                      XL464k24ex.5p                                                                                                                                                                                                                                                                                 CAAAGAGTTCTATCCATTCATCAACAGACCATACAATACTGAAGGTTTGGGGTCATTCCCTACTTATGCACCCCCAGGAAGTCACCTGCCACCATTTGTATCCTCTTACAATTCAACGTATTCTAAATATTTATTACCACCCTATGGCATTGGCTGTAATGGACTCAATTCATTGAACAATATTAATAGTTTCAGTCCCTTCTCAAGGATGTACCCAGTTTATAGCAGTATGCTTGCAGGTGGAAGCCTTCCTCACCATTTGCTAGCCCATGCTGCCCTACCTGGTTCTCTACCACATGAGGGAGGACGTAGATTGCTGCAACCTGAGCTGCCACGAGACTTTCTTATTCCTGCACCCAATAGTGCCTTCTCCATCACAGGTGCTGCTGCGAGCATGAAAGACAAGCAGAGCAGTCCCACTAGTGGATCACCAACTGCTGGCACAGCTGCATCCTTAGAGCACATAATGCAACCTAAACCTACCTCAGCTGTGATGTCCACAAGCAGTGAAGAAGCCATCAATCTTATTAAGAGCAAAAGGAATATGACTGGTTACAAGACTCTCCCATACCCATTGAAAAAGCAAAATGGAAAGATCAAATACGAGTGTAATGTTTGCTCAAAAACATTTGGACAACTCTCAAACCTAAAGGT
  5   1   2       bld Ga12      out                        XL198i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAATGGAAAGATCAAATATGAATGTAATATTTGCTCAAAAACATTTGGACAACTCTCAAACCTTAAGGTGCATCTTCGGGTACACAGTGGGGAGCGACCGTTTAAATGCCAGACTTGCAATAAAGGATTCACTCAGCTGGCGCATTTACAGAAGCACTTTTTGGTACACACAGGGGAGAAGCCTCATGAATGTCAGGTTTGTCATAAACGGTTCAGCAGCACAAGCAATCTTAAGACCCACTTACGACTGCACTCTGGAGAGAAGCCCTACCAGTGCAAACTTTGTCCTGCAAAGTTTACTCAATTTGTTCATCTCAAACTGCACAAACGCCTTCACACAAGAGAGAGACCACACAAATGCATTCATTGCCACAAGAGCTACATCCACCTGTGCAGCCTCAACTTCCACATGAAAGGCAATTGCCCTGTATCTCCAAGACTGGGTTTGTCTATGGAGGATCTGAATCGAATCAATGACGAAATTGAAAAGTTTGACATCAGTGACAGTGCAGACCAGTTAGATGATATGGAAGATATGGACATGTCTCCTGCTGTGGAGAAAGAAATAATGACTCTTCTCAGGAGAGAGATAGATGAATCAAGCATGAAAGTGTCTGTCTCAAGGAATATGGGCAATGGACTTATCACATCCGGATGCAACTTTTATGACCGATCTGATGCAATAGTAATGAAGTTGCCTCATAGCTCTCCACTACCTCTGT
  5   1   2       bld Tbd7                                 XL108o19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTNGCTGGCGCATTTACAGAAGCACTTTTTGGTACACACAGGGGAGAAGCCTCATGAATGTCAGGTTTGTCATAAACGGTTCAGCAGCACAAGCAATCTTAAGACCCACTTACGACTGCACTCTGGAGAGAAGCCCTACCAGTGCAAACTTTGTCCTGCAAAGTTTACTCAATTTGTTCATCTCAAACTGCACAAACGCCTTCACACAAGAGAGAGACCACACAAATGCATTCATTGCCACAAGAGCTACATCCACCTGTGCAGCCTCAACTTCCACATGAAAGGCAATTGCCCTGTATCTCCAAGACTGGGTTTGTCTATGGAGGATCTGAATCGAATCAATGACGAAATTGAAAAGTTTGACATCAGTGACAGTGCAGACCAGTTAGATGATATGGAAGATATGGACATGTCTCCTGCTGTGGAGAAAGAAATAATGACTCTTCTCAGGAGAGAGATAGATGAATCAAGCATGAAAGTGTCTGTCTCAAGGAATATGGGCAATGGACTTATCACATCCGGATGCAACTTTTATGACCGATCTGATGCAATAGTAATGAAGTTGCCTCATAGCTCTCCACTACCTCTGTTACCTGTAAAGGTCAAACAAGAATCCTTTGATCAAATGGACTCTTAACAGAAAGAAGAAT
  3   1   2      seed Ga12                                 XL161m14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATCGAATCAATGACGAAATTGAAAAGTTTGACATCAGTGACAGTGCAGACCAGTTAGATGATATGGAAGATATGGACATGTCTCCTGCTGTGGAGAAAGAAATAATGACTCTTCTCAGGAGAGAGATAGATGAATCAAGCATGAAAGTGTCTGTCTCAAGGAATATGGGCAATGGACTTATCACATCCGGATGCAACTTTTATGACCGATCTGATGCAATAGTAATGAAGTTGCCTCATAGCTCTCCACTACCTCTGTTACCTGTAAAGGTCAAACAAGAATCCTTTGATCAAATGGACTCTTAACAGAAAGAAGAATTAAGTGTTATTTATGGGGTCAGGATACTCTTAGCAATTATTTGTATATATTTATGTAGCTATGTCATNGTGTTGGCCTGGGGAGGTAAAACTCTCTAAGAGCCCTATTTGAAAAGAAGGATCTCCGAGATAACTATTCTCAGGGCATGGAAAAAGGCAGGGAAATGTGTGTATTGCCTACTCACTTATTAATTCTATCACTGAAAGACAATCATTTATCCATAATTATATGTCATTGAAATTATTTCATAATTTATTATGCAATTTATCATACTTAAAGCAATAATTATCAAATGTTTACAATGAGGGGAAAAAATCATTGTAATTTCAATCTATATATATATACAGTATATATTTATGTATATATGTNTCANGTGGCCATTT
  5   1   2       bld Emb1                   IMAGE:6637323-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAGATAGATGAATCAAGCATGAAAGTGTCTGTCTCAAGGAATATGGGCAATGGACTTATCACATCCGGATGCAACTTTTATGACCGATCTGATGCAATAGTAATGAAGTTGCCTCATAGCTCTCCACTACCTCTGTTACCTGTAAAGGTCAAACAAGAATCCTTTGATCAAATGGACTCTTAACAGAAAGAAGAATTAAGTGTTATTTATGGGGTCAGGATACTCTTAGCAATTATTTGTATATATTTATGTAGCTATGTCATTGTGTTGGCCTGGGGAGGTAAAACTCTCTAAGAGCCCTATTTGAAAAGAAGGATCTCCGAGATAACTATTCTCAGGGCATGGAAAAAGGCAGGGAAATGTGTGTATTGCCTACTCACTTATTAATTCTATCACTGAAAGACAATCATTTATCCATAATTATATGTCATTGAAATTATTTCATAATTTATTATGCAATTTATCATACTTAAAGCAATAATTATCAAATGTTTACAATGAGCGGAAAAAATCATTGTAATTTCAATCtatatatatatacagtatatatttatgtatatatGTTTCATGTGGCCATTTATGTAGATATTTTCTGCACATATAAGTTacaaaagaaaaaaagaaacaacagaaaaCCTAAGATTTGACAAGTATTTATAGGATCTGCATACCAAATGAACAATTTTTGTTGCCAAAGCTGCACATTAGACTT
  5   1   2       bld Emb1                            IMAGE:6637323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATAGATGAATCAAGCATGAAAGTGTCTGTCTCAAGGAATATGGGCAATGGACTTATCACATCCGGATGCAACTTTTATGACCGATCTGATGCAATAGTAATGAAGTTGCCTCATAGCTCTCCACTACCTCTGTTACCTGTAAAGGTCAAACAAGAATCCTTTGATCAAATGGACTCTTAACAGAAAGAAGAATTAAGTGTTATTTATGGGGTCAGGATACTCTTAGCAATTATTTGTATATATTTATGTAGCTATGTCATTGTGTTGGCCTGGGGAGGTAAAACTCTCTAAGAGCCCTATTTGAAAAGAAGGATCTCCGAGATAACTATTCTCAGGGCATGGAAAAAGGCAGGGAAATGTGTGTATTGCCTACTCACTTATTAATTCTATCACTGAAAGACAATCATTTATCCATAATTATATGTCATTGAAATTATTTCATAATTTATTATGCAATTTATCATACTTAAAGCAATAATTATCAAAATGTTTTACAATTGAGCCGGGAAAAAAATCCATTGTAAATTTTCCATCCTATATTATATATACCCGCAATAATAATTTAATGGAAAATAAGGTTTTCATGGTGGCCCATTTTTATGGTAAAATAATTTTTCCTGGCACCATATTTAGGTTTCCCaaaaggaaaaaaaggaaaacccccggaaaaaCCCTTAGGAATTTTGACCAAGTAATTTTAAAAGGGAATCTGGCCATAACCCAAAATGAAACAAATTTTTTTGTTGGCCCAAAGGCTGG
  5   1   2       bld Ga15      out                      XL446o19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGATCTCCGAGATAACTATTCTCAGGGCATGGAAAAAGGCAGGGAAATGTGTGTATTGCCTACTCACTTATTAATTCTATCACTGAAAGACAATCATTTATCCATAATTATATGTCATTGAAATTATTTCATAATTTATTATGCAATTTATCATACTTAAAGCAATAATTATCAAATGTTTACAATGAGGGGAAAAAATCATTGTAATTTCAATCtatatatatatacagtatatatttatgtatatatgtttcatgtggccatttatgtagatattttctgcacatataagttacaaaagaaaaaaagaaacaacagaaaaCCTAAGATTTGACAAGTATTTATAGGATCTGCATACCAAATGAACAATTTTTGTTGCCAAAGCTGCACATTAGACTTGTTGGATCCGTAGCtttttttttttttNCTT
  5   1   2       bld Ga15                               XL455e21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAATGAGGGGAAAAAATCNTTGTAATTTCNATCtatatatatatacngtatatatttatgtatatatGTTTCATGTGGCCATTTATGTAGATATTTTCTGCACATATAAGTTACaaaagaaaaaaagaaacnacagaaaaCCTAAGATTTGACAAGTATTTATAGGATCTGCATACCAAATGAACAATTTTTGTTGCCAAAGCTGCACATTAGACTTGTTGGATCCGTAGCttttttttttttNNTTTNCAAANGGNNTNGAGGGTTTNNC
  5   1   2       bld Ga15                               XL457f13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAATGAGGGGAAAAAATCATTGTAATTTCAATCtatatatatatacagtatatatttatgtatatatGTTTCATGTGGCCATTTATGTAGATATTTTCTGCACATATAAGTTACaaaagaaaaaaagaaacaacagaaaaCCTAAGATTTGACAAGTATTTATAGGATCTGCATACCAAATGAACAATTTTTGTTGCCAAAGCTGCACATTAGACTTGTTGGATCCGTAGCttttttttttttNCTTTNCAAAAGGNNTNGANGGTTTNNCCTTTNAAccccccccTTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)