Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012779422 Xl3.1-IMAGE:5440173.3 - 7 ESTs
                                                                       .-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5440173.3                                                                                                                          TTTTTCGTTATGAAACACCAGTCACACATCTATATTTCGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGAATGACATGCCCACGTTTGGTGGAATTGGTTGTTTGTGCCAATGGACTGCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTTGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAAACCGCACCTTAGGTCTCCCGTACATCTGCATGGAAAGCTAAATTAATAATTTTTTATTTGTTGTATAATTGTTTAGATGATGCATGTAGGCACTAATTTATCAAACAATTCATAGCAATCAGGATCAAGTAGGGACCATTTAATTGCATTTTTTTTAAATCGTAAACTACATTAAAAATCTGGTTGTCTATAACATGAACCAAACAGGCATCATTCTCTCGGTCCCAGGCAGTAAAAATTATTTTGTTCTTACTTGTTTTGGTCAGAAAACACAATAGTACAAAAAATGTAACATTATAA
                                                  Xl3.1-CHK-1012699761                                                                                                                                GTTATGAAACACCAGTCACACATCTATATTTCGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGAATGACATGCCCACGTTTGGTGGAATTGGTTGTTTGTGCCAATGGACTGCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTTGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAAACCGCACCTTAGGTCTCCCGTACATCTGCATGGAAAGCTAAATTAATAATTTTTTATTTGTTGTATAATTGTTTAGATGATGCATGTAGGCACTAATTTATCAAACAATTCATAGCAATCAGGATCAAGTAGGGACCATTTAATTGCATTTTTTTTAAATCGTAAACTACATTAAAAATCTGGTTGTCTATAACATGAACCAAACAGGCATCATTCTCTCGGTCCCAGGCAGTAAAAATTATTTTGTTCTTACTTGTTTTGGTCAGAAAACACAATAGTACAAAAAATGTAACATTATAAAAAATA
                                                      consensus depths                                                                                                                               3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     4     4     3     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2
  5   1   2       bld Lmb2                            IMAGE:8639506.5p GAATCCGGTCAGACCCAGTTCCACACAATCCAGAAAAGCAGCTGGGATGCTCTGATAAAACACTCTCCTAAAGTCAATTTGGTTATGTACTTTTTCCTTTATGAAGAGGAGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATCTATATTTCGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGAATGACATGCCCACGTTTGGTGGAATTGGTTGTTTGTGCCAATGGACTGCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTTGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAAACCGCACCTTAGGTCTCCCGTaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2       bld Egg4                   IMAGE:3744294-IMAGp.IMAGp                                                                                                              CGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATCTATATTTCGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGAATGACATGCCCACGTTTGGTGGAATTGGTTGTTTGTGCCAATGGACTGCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTTGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAATGCGCACCTTAGGTCTCCCGTACATCTGCATGGAAAGCTAAATTAATAATTTTTTATTTGTTGTATAATTGTTTAGATGATGCATGTAGGCACTAATTTATCAAACAATTCATAGCAATCAGGATCAAGTAGGGACCATTTAATTGCAttttttttAAATCGTAAACTACATTAAAAATCTGGTTGTCTaaaaaaaaaaaaaaa
  3   1   2       bld Emb4      out                   IMAGE:5440173.3p                                                                                                                  NGATCCATTTATTCGTTATGAAACACCAGTCACACATCTATATTTCGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGATTGACATGCACACGTTTGGTGGAATTGGTTGTTTGTGCCAATGGACTGCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTTGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAAACCGCACCTTAGGTCTCCCGTACATCTGCATGGAAAGCTAAATTAATAATTTTTTATTTGTTGTATAATTGTTTAGATGATGCATGTAGGCACTAATTTATCAAACAATTCATAGCAATCAGGATCAAGTAGGGACCATTTAATTGCATTTTTTTTAAATCGTAAACTACATTAAAAATCTGGTTGTCTATAACATGAACCAAACAGGCATCATTCTCTCAGTCCCAGGCAGTAAAAATTATTTTGTTCTTACTTGTTTTGGTCAGAAAACACAATAGTACAAAAAATGTAACATTATAAAAACTAGAATGGTTGCAATTACCCCAAGCTTTCGAGTTGACAAATACAATGAGNNACCACCACCAATAGT
  5   1   2       bld Egg4      in                    IMAGE:3744294.5p                                                                                                                             TTCGTTATGAAACACCAGTCACACATCTATATTTCGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGAATGACATGCCCACGTTTGGTGGAATTGGTTGTTTGTGCCAATGGACTGCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTTGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAAACCGCACCTTANGTCTCCCGTACATCTGCATGGAAAGCTAAATTAATACATTTTTATTTGTTGTATAATTGT
  3   1   2      seed Egg4      in                    IMAGE:3744294.3p                                                                                                                                                 ACACATCTATATTTCGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGAATGACATGCCCACGTTTGGTGGAATTGGTTGTTTGTGCCAATGGACTGCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTTGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAAACCGCACCTTAGGTCTCCCGTACATCTGCATGGAAAGCTAAATTAATAATTTTTTATTTGTTGTATAATTGTTTAGATGATGCATGTAGGCACTAATTTATCAAACAATTCATAGCAATCAGGATCAAGTAGGGACCATTTAATTGCATTTTTTTTAAATCGTAAACTACATTAAAAATCTGGTTGTCTAA
  5   1   2       bld Ov1       in                    IMAGE:5047259.5p                                                                                                                                                                                                                                                                             GACGCGTGGTTGAGCCCTGCAAGAGTCTAACAGCCATTGGACTTGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAAACCGCACCTTAGGTCTCCCGTACATCTGCATGGAAAGCTAAATTAATAATTTTTTATTTGTTGTACAATTGTTTAGATGATGCATGTAGGCACTAATTTATCAAACAATTCATAGCAATCAGGATCAAGTAGGGACCATTTAATTGCAttttttttAAATCGTAAACTACATTAAAAATCTGGTTGTCTATAACATGAACCAAACAGGCATCATTCTCTCGGTCCCAGGCAGTAAAAATTATTTTGTTCTTACTTGTTTTGGTCAGAAAAC
  3   1   2       bld Ov1       in                    IMAGE:5047259.3p                                                                                                                                                                                                                                                                                                                                                                         TGCGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAATGTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTCTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTCAAACTCTCTACTTGTAAATTAAACCGCACCTTAGGTCTCCCGTACATCTGCATGGAAAGCTAAATTAATAATTTTTTATTTGTTGTACAATTGTTTAGATGATGCATGTAGGCACTAATTTATCAAACAATTCATAGCAATCAGGATCAAGTAGGGACCATTTAGTGGCGTGTTTTAAAAATCGTAAACTACATTAAAAATCTGGTTGTCTATAACATAAACCAAACAGGCATCATTCTCTCGGTCCCAGGCAGTAAAAATTATTTTGTTCTTACTTGTTTTGGTCAGAAAACACAATAGTACAAAAAATGTAACATTATAAAAAATAGTATCTGTTACAATATACCAAAAGCTTTCATATTTGACAAAAACAATGCTGAAAGCCACCTACATAAAATATAAAGTCTGCAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)