Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6949584.3                      12 END     5          55       41                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:7018853.5                       4 PI      95          1      131                hypothetical protein LOC735076 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012779445 Xl3.1-IMAGE:6956771.5 - 9 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6956771.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGACAGTCAGTTCCAGGGACAGCCGGATCTCCGACTGACTGAGGAAGAGTCTCGTCTCCTGGGAAAGGAAGGAATAGTTTTACCCCAACACCTGCCCCTCACAAAGAATGAGGAGCGGGCGCTGAAACGTGTGCGCAGGAAAATCCGCAACAAGCGTTCTGCCCAGGAGAGTCGCAAGAAGAAGAAGGAGTATGTGGACGGGCTGGAGAACAGGGTCACTGCCTGTACCACCCAAAACCACTTGCTACAGAATCAGGTTCAGCAGCTGCAGAAACAGAATCGGACGTTGCTGCAGCAGCTCCGGAGCCTCCAGACTTTACTGAGACAGACGGGAGTGAAGACTACAACATCCAGCACCTGTGTCATGGTTCTGCTCCTGTCCTTCAGCCTCATCCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACGGCCGGCACACGGTCCTATCCCGGCAGTTGCGGGAGCTCCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGCAGAACGGGGGTGTCGATGTCCCACTGGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTTGATCCTGTGCTGCAGGGGGCCCAAAATGACACCCCAGAAGTGCAGGACGTGGGCACGGCAGAATCCAAACCTACTGGCAACACTAACTCTTCATTTGATCTCCCGGGAGACAGTGAGCCTGGCATCAACATACAATCTGGCTCCTCCTCCAACCCTGCCCCCGATGTCCCTGATGCCCGATATGTCATGCAGGAGAAGCACGATTGGCTGGAAAGGACTCGCAGTGTGGTGATCACTCCCCTGCACTCTGATGAGATGTAACCCAGGCAATACTGCAGCCCATTGTGCTATCACTGGTGCAGTTTAGCCAATAAGGAATTATGTGCTGAGGGTTGTGGCACTGCCCGTCCATTGTGCTATCACTGGTGCAGGTTGCCCCTGTATATCATATGCTGCCCGTGAGAGCACTGCCTGCCTCAGCCTGGTGCATTGTGGGCCTACAAATAATTCAGGGTCAGTGAGCTGCTTGTTTTGCCCATAGTGACATCCCTACTGTAGTGTCCCATTGTATATCCCCATTGTATATGATTACGTGGGTTATACCCCTGCCTGGCGCTACCCACTGTGCTGTCTGTGGCCCCTGTAAATCAGCGGATTGT
                                                  Xl3.1-CHK-1012697601                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGTTCCAGGGACAGCCGGATCTCCGACTGACTGAGGAAGAGTCTCGTCTCCTGGGAAAGGAAGGAATAGTTTTACCCCAACACCTGCCCCTCACAAAGAATGAGGAGCGGGCGCTGAAACGTGTGCGCAGGAAAATCCGCAACAAGCGTTCTGCCCAGGAGAGTCGCAAGAAGAAGAAGGAGTATGTGGACGGGCTGGAGAACAGGGTCACTGCCTGTACCACCCAAAACCACTTGCTACAGAATCAGGTTCAGCAGCTGCAGAAACAGAATCGGACGTTGCTGCAGCAGCTCCGGAGCCTCCAGACTTTACTGAGACAGACGGGAGTGAAGACTACAACATCCAGCACCTGTGTCATGGTTCTGCTCCTGTCCTTCAGCCTCATCCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACGGCCGGCACACGGTCCTATCCCGGCAGTTGCGGGAGCTCCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGCAGAACGGGGGTGTCGATGTCCCACTGGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTTGATCCTGTGCTGCAGGGGGCCCAAAATGACACCCCAGAAGTGCAGGACGTGGGCACGGCAGAATCCAAACCTACTGGCAACACTAACTCTTCATTTGATCTCCCGGGAGACAGTGAGCCTGGCATCAACATACAATCTGGCTCCTCCTCCAACCCTGCCCCCGATGTCCCTGATGCCCGATATGTCATGCAGGAGAAGCACGATTGGCTGGAAAGGACTCGCAGTGTGGTGATCACTCCCCTGCACTCTGATGAGATGTAACCCAGGCAATACTGCAGCCCATTGTGCTATCACTGGTGCAGTTTAGCCAATAAGGAATTATGTGCTGAGGGTTGTGGCACTGCCCGTCCATTGTGCTATCACTGGTGCAGGTTGCCCCTGTATATCATATGCTGCCCGTGAGAGCACTGCCTGCCTCAGCCTGGTGCATTGTGGGCCTACAAATAATTCAGGGTCAGTGAGCTGCTTGTTTTGCCCATAGTGACATCCCTACTGTAGTGTCCCATTGTATATCCCCATTGTATATGATTACGTGGGTTATACCCCTGCCTGGCGCTACCCACTGTGCTGTCTGTGGCCCCTGTAAATCAGCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     3     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     3     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     5     6     5     6     5     6     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       ...PROTEIN --- Dm ---- 3e-024     NP_996096.1 CG7450-PB, isoform B [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 3e-032     NP_491897.2 F57B10.1 [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ag ---- 3e-035     XP_321663.3 AGAP001464-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 6e-037     NP_001071675.1 transcription factor protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 1e-037     XP_001180340.1 PREDICTED: similar to CAMP responsive element binding protein 3-like 3 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 4e-041     XP_855139.1 PREDICTED: similar to cAMP responsive element binding protein 3-like 4 [Canis familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 4e-041     NP_663340.1 cAMP responsive element binding protein 3-like 3 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 4e-042     NP_006359.3 cAMP responsive element binding protein 3 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Bt ---- 2e-042     XP_885877.2 PREDICTED: similar to androgen-induced basic leucine zipper isoform 2 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dr ---- 7e-049     NP_998697.1 zgc:66452 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 1e-055     XP_424990.1 PREDICTED: similar to Zgc:66452 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ---- 5e-122     NP_001106391.1 cAMP responsive element binding protein 3 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Xl ---- 5e-157     NP_001090005.1 hypothetical protein LOC735076 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6956771.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATGTAA------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------TAA------------------------------------------------TAG---------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Ga18      out                     xlk146h17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNCAGAGCCAAGGGAGCTGATTAGTGTGAGCATggaggaggaggaggaggaggaggagAGTGAAGAATGTGACAGTCAGTTCCAGGGACAGCCGGATCTCCGACTGACTGAGGAAGAGTCTCGTCTCCTGGGAAAGGAAGGAATAGTTTTACCCCAACACCTGCCCCTCACAAAGAATGAGGAGCGGGCNNTGAAACGTGTGCGCAGGAAAATCCGCAACAAGCGTTCTGCCCAGGAGAGTCGCAAGAAGAAGAAGGAGTATGTGGACGGGCTGGAGAACAGGGTCACTGCCTGTACCACCCAAAACCACTTGCTACAGAATCAGGTTCAGCAGCTGCAGAAACAGAATCGGACGTTGCTGCAGCAGCTCCGGAGCCTCCAGACTTTACTGAGACAGACGGGAGNGAAGACTACAACATCCAGCACCTGTGTCATGGTTCTGCTCCTGTCCTTCAGCCTCATCCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACGGCCGGCACACGGTCCTATCCCGGCAGTTGNGNNNNNNCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGCAGAACGGGGGTGTCGATGTCCCACTGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTNGATCCTGTGCTGCAGGNNNNNNAAAATGACACCCCAGAAGNNCAGGACGNGGGCNCGGNAGAATCCAAACCTACTGGCAACACTAACTCTTCATTTGATCTCCCGGGAGANAGTGAG
  5   1   2       bld Brn1      out                   IMAGE:6956771.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGACAGTCAGTTCCAGGGACAGCCGGATCTCCGACTGACTGAGGAAGAGTCTCGTCTCCTGGGAAAGGAAGGAATAGTTTTACCCCAACACCTGCCCCTCACAAAGACTGAGGAGCGGGCGCTGAAACGTGTGCGCAGGAAAATCCGCAACAAGCGTTCTGCCCAGGAGAGTCGCAAGAAGAAGAAGGAGTATGTGGATGGGCTGGAGAACAGGGTCACTGCCTGTACCACCCAAAACCACTTGCTACAGAATCAGGTTCAGCAGCTGCAGAAACAGAATCGGACGTTGCTGCAGCAGCTCCGGAGCCTCCAGACTTTACTGAGACAGACGGGAGTGAAGACTACAACATCCAGCACCTGTGTCATGGTTCTGCTCCTGTCCTTCAGCCTCATCCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACGGCCGGCACACGGTCCTATCCCGGCAGTTGCGGGAGCTCCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGCAGAACGGGGGTGTCGATGTCCCACTGGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTTGATCCTGTGCTGCAGGGGGCCCAAAATGACACCCCAGAAGTGCAGGACGTGGGCACGGCAGAATCCAAACCTACTGGCAACACGAACTCTTCATTTGATCTCCCGGGAGACAGTGAGCCTGGCATCAACATACAATCTGGCTCCTCCTCCAACCCTGCCCCCGATGTCCCTGATGCCCGATATGTCATGGCAGGAGAAGCACGATTGGCTGGAAAGGACTCGCAGTGTGGTGATCACTCCCC
  5   1   2      skin Tbd7      out                        XL103b14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAAAGGAAGGAATAGTTTTACCCCAACACCTGCCCCTCACAAAGGAANGAGGAGCGGGCGCTGAAACGTGTGCGCAGGAAAATCCGCAACAAGCGTTCTGCCCAGGAGAGTCGCAAGAAGAANAAGGAGTATGTGGACGGGCTGGAGA
  5   1   2       bld Ga15      out                      XL431l02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCCCAGTTGTATGTGCCTCTGGCTAATGCCACGCCCAGTGTATGTGCCTCTGGCTAATGCCACGCCCAGTGTATGTGCCTCTGGCTAATGCCACGCCCAGTGTATGTGCCTCTGGCTAATGCCCAGTCTAAGTGAAGTGCCTTGTGTTACCGCAGGACGTTGCTGCAGCAGCTCCGGAGCCTCCAGACTTTACTGAGACAGACGGGAGTGAAGACTACAACATCCAGCACCTGTGTCATGGTTCTGCTCCTGTCCTTCAGCCTCATCCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACGGCCGGCACACGGTCCTATCCCGGCAGTTGCGGGAGCTCCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGCAGAACGGGGGTGTCGATGTCCCACTGGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTTGATCCTGTGCTGCAGGGGGCCCAAAATGACACCCCAGAAGTGCAGGACGTGGGCACGGCAGAATCCAAACCTACTGGCAACACTAACTCTTCATTTGATCTCCCGGGAGACAGTGAGCCTGGCATCAACATACAATCTGGCTCCTCCTCCAACCCTGCCCCCGATGTCCCTGATGCCCGATATGTCATGCANGANAAGCACGATTGGCTGGAAAGGACTCGCAGTGTGGTGATCACTCCCCTGCACTCTGATGANATGTAACCCANGCAATACTGCANCCCATTGTGCTATCACTGGTGCAGTTTANCCAATAANGAATTATGTGCTGAGGGTTGTGGCACTGCCCGTCCATTGTGCTATCACTGGTGCA
  5   1   2       bld Tbd7      in                         XL106k11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGGAGAACAGGGTCACTGCCTGTACCACCCAAAACCCTTGCTACAGAATCAGGTTCAGCAGCTGCAGAAACAGAATCGGTCGTTGCTGCAGCAGCTCCGGAGCCTCCAGACTTTACTGAGACAGACGGGAGTGAAGACTACAACATCCAGCACCTGTGTCATGGTTCTGCTCCTGTCCTTCAGCCTCATCCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACGGCCGGCACACGGTCCTATCCCGGCAGTTGCGGGAGCTCCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGTAGAACGGGGGTGTCGATGTCCCACTGGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTTGATCCTGTGCTGCAGGGGGCCCAAAATGACACCCCAGAAGTGCAGGACGTGGGCACGGCAGAATCCAAACCTACTGGCAACACTAACTCTTCATTTGATCTCCCGGGAGACAGTGAGCCTGGCATCAACATACAATCTGGCTCCTCCTCCAACCCTGCCCCCGATGTCCCTGATGCCCGATATGTCATGCAGGAGAAGCACGATTGGCTGGAAAGGACTCGCAGTGTGGTGATCACTCCCCTGCACTCTGATGAGATGTAACCCAGGCAATACTGCAGCCC
  5   1   2      seed Ov1                             IMAGE:5048450.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAATCAGGTTCAGCAGCTGCAGAAACAGAATCGGACGTTGCTGCAGCAGCTCCGGAGCCTCCAGACTTTACTGAGACAGACGGGAGTGAAGACTACAACATCCAGCACCTGTGTCATGGTTCTGCTCCTGTCCTTCAGCCTCATCCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACGGCCGGCACACGGTCCTATCCCGGCAGTTGCGGGAGCTCCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGCAGAACGGGGGTGTCGATGTCCCACTGGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTTGATCCTGTGCTGCAGGGGGCCCAAAATGACACCCCAGAAGTGCAGGACGTGGGCACGGCAGAATCCAAACCTACTGGCAACACTAACTCTTCATTTGATCTCCCGGGAGACAGTGAGCCTGGCATCAACATACAATCTGGCTCCTCCTCCAACCCTGCCCCCGATGTCCCTGATGCCCGATATGTCATGCAG
  5   1   2       bld Ov1       out                   IMAGE:5048921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATATCGTCGACCCACGCGTCCGAGCTCCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGCAGAACGGGGGTGTCGATGTCCCACTGGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTTGATCCTGTGCTGCAGGGGGCCCAAAATGACACCCCAGAAGTGCAGGACGTGGGCACGGCAGAATCCAAACCTACTGGCAACACTAACTCTTCATTTGATCTCCCGGGAGACAGTGAGCCTGGCATCAACATACAATCTGGCTCCTCCTCCAACCCTGCCCCCGATGTCCCTGATGCCCGATATGTCATGCAGGAGAAGCACGATTGGCTGGAAAGGACTCGCAGTGTGGTGATCACTCCCCTGCACTCTGATGAGATGTAACCCAGGCAATACTGCAGCCCATTGTGCTATCACTGGTGCAGTTTAGCCAATAAGGAATTATGTGCTGAGGGTTGTGGCACTGCCCGTCCATTGTGCTATCACTGGTGCAGGTTGCCCCTGTATATCATATGCTGCCCGTGAGAGCACTGCCTGCCTCAGCCTGGTGCATTGTGGGCCTACAAATAATTCAGGGTCAGTGAGCTGCTTGTTTTGC
  5   1   2       bld Ov1                    IMAGE:5048921-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTCCCAGGCCTCTCACAAGTGCCACATGTGGGTGTTGGGCAGAACGGGGGTGTCGATGTCCCACTGGGGAAACAAGAGGAGAATCTGCTGGACTTGCACCTTGATCCTGTGCTGCAGGGGGCCCAAAATGACACCCCAGAAGTGCAGGACGTGGGCACGGCAGAATCCAAACCTACTGGCAACACTAACTCTTCATTTGATCTCCCGGGAGACAGTGAGCCTGGCATCAACATACAATCTGGCTCCTCCTCCAACCCTGCCCCCGATGTCCCTGATGCCCGATATGTCATGCAGGAGAAGCACGATTGGCTGGAAAGGACTCGCAGTGTGGTGATCACTCCCCTGCACTCTGATGAGATGTAACCCAGGCAATACTGCAGCCCATTGTGCTATCACTGGTGCAGTTTAGCCAATAAGGAATTATGTGCTGAGGGTTGTGGCACTGCCCGTCCATTGTGCTATCACTGGTGCAGGTTGCCCCTGTATATCATATGCTGCCCGTGAGAGCACTGCCTGCCTCAGCCTGGTGCATTGTGGGCCTACAAATAATTCAGGGTCAGTGAGCTGCTTGTTTTGCCCATAGTGACATCCCTACTGTAGTGTCCCATTGTATATCCCCATTGTATATCATTACGTGGGTTATACCCCTGCCTGGCGCTACCCACTGTGCTGTCTGTGGCCCCTGTAAATCAGCGGATTGTAT
  3   1   2       bld Tbd7      in                         XL106k11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCATGCAGNAGAAGCACGATTGGCTGGAAAGGACTCGCAGTGTGGTGATCACTCCCCTGCACTCTGATGAGATGTAACCCAGGCAATACTGCAGCCCATTGTGCTATCACTGGTGCAGTTTAGCCAATAAGGAATTATGTGCTGAGGGTTGTGGCACTGCCCGTCCATTGTGCTATCACTGGTGCAGGTTGCCCCTGTATATCATATGCTGCCCATGAGAGCACTGCCTGCCTCAGCCTGGTGCATTGTGGGCCTACAAATAATTCAGGGTCAGTGAGCTGCTTGTTTTGCCCATAGTGACATCCCTACTGTAGTGTCCCATTGTATATCCCCATTGTATATGATTACGTGGGTTATACCCCTGCCTGGCGCTACCCACTGTGCTGTCTGTGGCCCCTGTAAATCAGCGGATTGTATGGGTTACGCTGTTGATTGCCCATTGTGATATCCCTGGTGCATGTAAATTGCTATGATCTGAGGCAACATCATTATATTCTGATAATCTGCACTTACCCCAGCGCCATGGAACCTGACCTGCCCCTCCCCCGCACTCTGTGCTCCTGTGTTTACCTCCGTTAGTTTAGAATTTGGGAACAATTGGGGGAGGTTTGAGTTCTCTTACTGGAATGGGTGGTCCCAGGACTGGTGCCGCTTTGCACTTTGATGTAAATATATATATGTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)