Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7202248.5                      14 END     2          33       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl312j05.5                           47 PI      80         49      490                (no blast hit)
     3   0.0    0Xl3.1-XL483c07ex.5                         17 PI      78         52      501                ubiquitin conjugating enzyme E2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012779477 Xl3.1-XL500n01ex.5 - 6 ESTs
                                                                       ........-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL500n01ex.5                                                                                                                                                                                                                           AGCTCACCCGAACACCCGCCCGGCACCGGCAGCAGTAGCGACAGAATTATGGCGCTGAAACGGATCCACAAGGAACTCAATGATTTGGCTCGTGATCCTCCAGCTCAGTGTTCCGCCGGCCCTGTTGGAGATGATATGTTTCACTGGCAAGCCACAATAATGGGACCTAATGACAGCCCATATCAAGGCGGTGTGTTTTTCTTGACGATTCATTTCCCAACAGACTATCCCTTTAAACCTCCTAAAGTTGCGTTTACAACAAGAATCTACCATCCAAATATTAACAGCAATGGCAGCATTTGTCTTGATATTCTCAGATCACAGTGGTCCCCAGCTTTAACTATTTCTAAAGTTCTTTTGTCAATTTGTTCACTGTTGTGTGACCCAAACCCAGATGACCCTCTAGTGCCAGAGATTGCACGCATCTACAAAACAGATAGGGAAAAGTACAACAGAATAGCCCGGGAATGGACTCAGAAGTATGCTATGTGATGCTACCTTCAAGTCTGAATAACCTGCATTATAGCTGGAATAAACTTTAAATTACTGTTTTCCCTCTCCCTTTCAGACCTCATCTACTTACCTTTCCCCACTTCTTTTTTTTTTTTTTTT
                                                  Xl3.1-CHK-1012701235                                                                                                                                                                                                                                 CCCGAACACCCGCCCGGCACCGGCAGCAGTAGCGACAGAATTATGGCGCTGAAACGGATCCACAAGGAACTCAATGATTTGGCTCGTGATCCTCCAGCTCAGTGTTCCGCCGGCCCTGTTGGAGATGATATGTTTCACTGGCAAGCCACAATAATGGGACCTAATGACAGCCCATATCAAGGCGGTGTGTTTTTCTTGACGATTCATTTCCCAACAGACTATCCCTTTAAACCTCCTAAAGTTGCGTTTACAACAAGAATCTACCATCCAAATATTAACAGCAATGGCAGCATTTGTCTTGATATTCTCAGATCACAGTGGTCCCCAGCTTTAACTATTTCTAAAGTTCTTTTGTCAATTTGTTCACTGTTGTGTGACCCAAACCCAGATGACCCTCTAGTGCCAGAGATTGCACGCATCTACAAAACAGATAGGGAAAAGTACAACAGAATAGCCCGGGAATGGACTCAGAAGTATGCTATGTGATGCTACCTTCAAGTCTGAATAACCTGCATTATAGCTGGAATAAACTTTAAATTACTGTTTTCCCTCTCCCTTTCAGACCTCATCTACTTACCTTTCCCCACTTCTTTTTTTTTTTTTTTTTTTTAT
                                                      consensus depths                                                                                                                                                                                                                                3     4     3     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3
                                               BLH ATG      48    1030                                                                                                                                                                                                                           
                                               BLH MIN      48     107                                                                                                                                                                                                                           
                                               BLH MPR      48     107                                                                                                                                                                                                                           
                                               BLH OVR      48     230                                                                                                                                                                                                                           
                                               CDS MIN      48     107                                                                                                                                                                                                                           
                                               ORF LNG      48       3                                                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 3e-071     XP_001184037.1 PREDICTED: similar to ubiquitin-conjugating enzyme [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Ce ==== 1e-081     NP_502065.1 Ubiquitin conjugating enzyme UBC-2, LEThal LET-70 (16.7 kD) (let-70)[Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dm ==== 7e-082     NP_731941.1 effete CG7425-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Ag ==== 4e-082     XP_310998.2 ENSANGP00000019908 [Anopheles gambiae str. PEST] =============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 2e-084     NP_001026324.1 ubiquitin-conjugating enzyme E2D 3 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 3e-085     NP_957253.1 similar to ubiquitin-conjugating enzyme E2D 2 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 4e-086     NP_001084434.1 ubiquitin conjugating enzyme E2 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 4e-086     CAJ81618.1 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Cf ==== 3e-086     XP_855983.1 PREDICTED: similar to Ubiquitin-conjugating enzyme E2 D2 (Ubiquitin-protein ligase D2) (Ubiquitin carrier protein D2) (Ubiquitin-conjugating enzyme E2-17 kDa 2) (E2(17)KB 2) isoform 5 [Canis familiaris] ===================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Mm ==== 3e-086     XP_001476589.1 PREDICTED: similar to Chain B, Crystal Structure Of Human Ubiquitin-Conjugating Enzyme Ubch5b [Mus musculus] ==============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 3e-086     NP_003330.1 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast); UbcH5B;ubiquitin-conjugating enzyme E2D 2 (homologous to yeast UBC4/5) [Homo sapiens] ============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Bt ==== 2e-086     NP_001039961.1 ubiquitin-conjugating enzyme E2D 2 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL500n01ex.5                                                                                                                                                                                                                                                                           ATG------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGA---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       bld Egg2 5g3  out                   IMAGE:5162501.5p GGGCGGAATAAAGAAGGCATCCTACGGGTCACTGAGTGGATCAACATACACCCACTTTTGTATTTAGGACCCATCGTTCCTTCCCGCTGTCATCATTCCCTCCCCCGCTTGTATTGAGAGGGCGGCTCCGGATTGTAGCGTGTCCCGGATATTGTACAAGGGggcctcaccacctcctgttccctcctccttctcttcctcgcctccctcctccgaccagctcccccgaacacccccccGGAACCGGCAGCAGTACCGACAGAATTATGGAGCTGAAACGGATCCACAAGGAACTCAATGATTTGGGTCGAGATCCTCCAGC
  5   1   2       bld Eye1 5x3                        IMAGE:6947388.5p                                                                                                                                                                                                               GGCTGGACCGGTCCGGAATTCTCCGGATCGCCCGGCACCGGCAGCAGTAGCGACAGAATTATGGCGCTGAAACGGATCCACAAGGAACTCAATGATTTGGCTCGTGATCCTCCAGCTCAGTGTTCCGCCGGCCCTGTTGGAGATGATATGTTTCACTGGCAAGCCACAATAATGGGACCTAATGACAGCCCATATCAAGGCGGTGTGTTTTTCTTGACGATTCATTTCCCAACAGACTATCCCTTTAAACCTCCTAAAGTTGCGTTTACAACAAGAATCTACCATCCAAATATTAACAGCAATGGCAGCATTTGTCTTGATATTCTCAGATCACAGTGGTCCCCAGCTTTAACTATTTCTAAAGTTCTTTTGTCAATTTGTTCACTGTTGTGTGACCCAAACCCAGATGACCCTCTAGTGCCAGAGATTGCACGCATCTACAAAACAGATAGGGAAAAGTACAACAGAATAGCCCGGGAATGGACTCAGAAGTATGCTATGTGATGCTACCTTCAAGTCTGAATAACCTGCATTATAGCTGGAATAAACTTTAAATTACTGTTTTCCCTCTCCCTTTCAGACCTCATCTACTTACCTTTCCCCACTTCNNTNttttttttttttttttattaattttatttgttttttttttgttgtttttttGTGCTGCCTCCCCTTATGCACATGCTCACATGGGAAGACTTTTAGTTCAGCATTGGACAGAAACTGCTATAGACTGTCCAATAGTTGCCAAAATACTATTGCCCAAGATATATAAACCTTTCAAAAGAACATGTGTTGTAACCTGGCCAACGGTCTTCActttaattttgttatgaaaactaaaacccctccctttattttttcacaaaaaaatggtgaaaaaaaaaCCCC
  5   1   2       bld Neu4 5x3                        IMAGE:4085185.5p                                                                                                                                                                                                                          CAGCTCACCCGAACACCCGCCCGGCACCGGCAGCAGTAGCGACAGAATTATGGCGCTGAAACGGATCCACAAGGAACTCAATGATTTGGCTCGTGATCCTCCAGCTCAGTGTTCCGCCGGCCCTGTTGGAGATGATATGTTTCACTGGCAAGCCACAATAATGGGACCTAATGACAGCCCATATCAAGGCGGTGTGTTTTTCTTGACGATTCATTTCCCAACAGACTATCCCTTTAAACCTCCTAAAGTTGCGTTTACAACAAGAATCTACCATCCAAATATTAACAGCAATGGCAGCATTTGTCTTGATATTCTCAGATCACAGTGGTCCCCAGCTTTAACTATTTCTAAAGTTCTTTTGTCAATTTGTTCACTGTTGTGTGACCCAAACCCAGATGACCCTCTAGTGCCAGAGATTGCACGCATCTACAAAACANATAGGGAAAAGTACAACAGAATAGCCCGGGAATGGACTCAGAAGTATGCTATG
  5   1   2      seed Ga15 5x3                           XL500n01ex.5p                                                                                                                                                                                                                           AGCTCACCCGAACACCCGCCCGGCACCGGCAGCAGTAGCGACAGAATTATGGCGCTGAAACGGATCCACAAGGAACTCAATGATTTGGCTCGTGATCCTCCAGCTCAGTGTTCCGCCGGCCCTGTTGGAGATGATATGTTTCACTGGCAAGCCACAATAATGGGACCTAATGACAGCCCATATCAAGGCGGTGTGTTTTTCTTGACGATTCATTTCCCAACAGACTATCCCTTTAAACCTCCTAAAGTTGCGTTTACAACAAGAATCTACCATCCAAATATTAACAGCAATGGCAGCATTTGTCTTGATATTCTCAGATCACAGTGGTCCCCAGCTTTAACTATTTCTAAAGTTCTTTTGTCAATTTGTTCACTGTTGTGTGACCCAAACCCAGATGACCCTCTAGTGCCAGAGATTGCACGCATCTACAAAACAGATAGGGAAAAGTACAACAGAATAGCCCGGGAATGGACTCAGAAGTATGCTATGTGATGCTACCTTCAAGTCTGAATAACCTGCATTATAGCTGGAATAAACTTTAAATTACTGTTTTCCCTCTCCCTTTCAGACCTCATCTACTTACCTTTCCCCACTTCtttttttttttttttttttaaaaaatttaattggnttttttttgggggttttttGGGGNNNCCCCCCCT
  5   1   2       bld Ga15 5g3  out                      XL469e21ex.5p                                                                                                                                                                                                                                                                       CATTATGGCGCTGAAACGGATCCACAAGGAACTCAATGATTTGGCTCGTGATCCTCCAGCTCAGTGTTCCGCCGGCCCAGTTGGAGATGATATGTTTCACTGGCAAGCAACAATAATGGGACCTAATGACAGCCCATATCAAGGTGGTGTGTTTTTCTTGACGATTCATTTTCCAACAGACTATCCCTTTAAACCTCCTAAAGTTGCGTTTACAACAAGAATCTACCATCCAAATATTAACAGCAATGGCAGCATTTGTCTTGATATTCTCAGATCACAGTGGTCCCCAGCTTTAACTATTTCTAAAGTTCTTTTGTCAATTTGTTCACTGTTGTGTGACCCAAACCCAGATGACCCTCTAGTGCCAGAGATTGCACGGATCTACAAAACAGATA
  5   1   2       bld Tbd5                            IMAGE:3579969.5p                                                                                                                                                                                                                                                                                                                          TCCTCCAGCTCAGTGTTCCGCCGGCCCTGTTGGAGATGATATGTTTCACTGGCAAGCCACAATAATGGGACCTAATGACAGCCCATATCAAGGCGGTGTGTTTTTCTTGACGATTCATTTCCCAACAGACTATCCCTTTAAACCTCCTAAAGTTGCGTTTACAACAAGAATCTACCATCCAAATATTAACAGCAATGGCAGCATTTGTCTTGATATTCTCAGATCACAGTGGTCCCCAGCTTTAACTATTTCTAAAGTTCTTTTGTCAATTTGTTCACTGATGTGTGACCCAAACCCAGATGACCCTCTAGTGCCAGAGATTGCACGCATCTACAAAACAGATAGGGAAAAGTACAACAGAATAGCCCGGGAATGGACTCAGAAGTATGCTATGTGATGCTACCTTCAAGTCTGAATAACCTGCATTATAGCTGGAATAAACTTTAAATTACTGTTTTCCCTCTCCCTTTCAGACCTCATCTACTTACCTTTCCCCACTTCtttttttttttttttttttATTAATTGTATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)