Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4030612.5                      13 END     1          25        7                nuclear cap binding protein subunit 1, 80kDa [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl226h11.5                           13 PI      92         36      966                MGC80276 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 94%

 1012779500 Xl3.1-xl325o19.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl325o19.5 ATTCGTCGACCCACGCGTCCGTCACGCGACTATCTCACGCTTGGCTTTGTGAGTAGCTGCCGGTCCCTGCCGGTGACACTGTGTTGTTTGAGGCAAAGTATTGCTCAGCGCCATGTCCAGGAGGAGGCACAGTGACGAGAATGATGGAGGACAACCTCACAAAAGGCGAAGAACCTCTGAACCCCTTGAGATCGAAGACCGATTGGAATCTTTGATATGCAGAGTTGGTGAAAAGAGTACATCCTCACTAGAGAGCAACCTAGAAGGTCTGGCTGGAGTTTTAGAAGCTGATCTGCCTAACTATAAAAACAAGATCTTAAGAATCCTTTGTTTTGTCGCTCGGTTGCTGCCTGAAAAAATGACTGTATACACTACATTAGTTGGGTTACTTAATGCCAGAAACTACAATTTTGGTGGTGAGTTTGTGGAAGCCATGATACGCCATCTCAAGGAGACCATTAAACTGAATGCTTACAATGAGGCAATATATTTAGTTCGTTTTCTTTGTGATCTTGTAAATTGCCATGTAATCGCAGCCCCATCGATGGTTGCCATGTTTGAAAGCTTTGTTGGGGTCACTCAGGAAGAAGATATTCCCCAGGTGCGAAGTGACTGGTATGTGTATGCAGTTCTTTCTTCACTGCCATGGGTTGGAAAAGAATTGTATGAGAAGAAAGATGTTGAGATGGATCAAATTTTATCCCAAATTGAGGCTTACTTGAAGCAACGGCAAAAGCTCCATCTCTCTATTCTGCAAGTATGGTCAGCAGAAAAACCACACCCACAGGAAGAGTATTTAGACTGCCTGTGGGCCCAAGTACAGAAGCTAAAAAAGGACCGCTGGCAGGAAAGACACATCCAACGTCCATACCTTGCCTTTGACAGTGTTCTGTGTGAAGCTTTGCAGCACAATCTTCCACCATTCACACCACCACCTCATACTGAAGATTCTGTGTACCCAGTGCCAAGAGTAATTTTCAGGATGTTTGATTACACAGATGCACCTGAGGGTCCAGTCATGCCTGGAAGTCATTCTGTAGAGCGCTTTGTTATAGAAGAAAATCTGCACTGTATACTTAAATCACATTGGCGTGAAAAGAAACATGTGCTGCTCAGCTGTTAAGCTACCCCAGAGAAGAACAAAATTTCCCTTGAACTATCACATAGGTTGAGGTGATCTTTTGGAAAGCTGGTTCAGTTACCTTCTCCCCCCACAGATTGACGTCATGTATACTACACTTCTAATCGAACCTTTGCAAAATGCAAACCTGGATCTTTGCCCCCAAGTGGCTTGCACCAACCCTCTGAAATGGGGGTAAA
                                                  Xl3.1-CHK-1012707489       CGACCCACGCGTCCGTCACGCGACTATCTCACGCTTGGCTTTGTGAGTAGCTGCCGGTCCCTGCCGGTGACACTGTGTTGTTTGAGGCAAAGTATTGCTCAGCGCCATGTCCAGGAGGAGGCACAGTGACGAGAATGATGGAGGACAACCTCACAAAAGGCGAAGAACCTCTGAACCCCTTGAGATCGAAGACCGATTGGAATCTTTGATATGCAGAGTTGGTGAAAAGAGTACATCCTCACTAGAGAGCAACCTAGAAGGTCTGGCTGGAGTTTTAGAAGCTGATCTGCCTAACTATAAAAACAAGATCTTAAGAATCCTTTGTTTTGTCGCTCGGTTGCTGCCTGAAAAAATGACTGTATACACTACATTAGTTGGGTTACTTAATGCCAGAAACTACAATTTTGGTGGTGAGTTTGTGGAAGCCATGATACGCCATCTCAAGGAGACCATTAAACTGAATGCTTACAATGAGGCAATATATTTAGTTCGTTTTCTTTGTGATCTTGTAAATTGCCATGTAATCGCAGCCCCATCGATGGTTGCCATGTTTGAAAGCTTTGTTGGGGTCACTCAGGAAGAAGATATTCCCCAGGTGCGAAGTGACTGGTATGTGTATGCAGTTCTTTCTTCACTGCCATGGGTTGGAAAAGAATTGTATGAGAAGAAAGATGTTGAGATGGATCAAATTTTATCCCAAATTGAGGCTTACTTGAAGCAACGGCAAAAGCTCCATCTGTCTATTCTGCAAGTATGGTCAGCAGAAAAACCACACCCACAGGAAGAGTATTTAGACTGCCTGTGGGCCCAAGTACAGAAGCTAAAAAAGGACCGCTGGCAGGAAAGACACATCCAACGTCCATACCTTGCCTTTGACAGTGTTCTGTGTGAAGCTTTGCAGCACAATCTTCCACCATTCACACCACCACCTCATACTGAAGATTCTGTGTACCCAGTGCCAAGAGTAATTTTCAGGATGTTTGATTACACAGATGCACCTGAGGGTCCAGTCATGCCTGGAAGTCATTCTGTAGAGCGCTTTGTTATAGAAGAAAATCTGCACTGTATACTTAAATCACATTGGCGTGAAAAGAAACATGTGCTGCTCAGCTGTTAAGCTACCCCAGAGAAGAACAAAATTTCCCTTGAACTATCACATAGGTTGAGGTGATCTTTTGGAAAGCTGGTTCAGTTACCTTCTCCCCCCACAGATTGACGTCATGTATACTACACTTCTAATCGAACCTTTGCAAAATGCAAACCTGGATCTTTGCCCCCAAGTGGCTTGCACCAACCCTCTGAAATGGG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     112     394 
                                               BLH MIN     112     202 
                                               BLH MPR      94     202 
                                               BLH OVR     112     228 
                                               CDS MIN     112     202 
                                               ORF LNG     112      15 
                                                                                                                                                                     PROTEIN --- ?? ---- 2e-036     XP_646314.1 initiation factor eIF-4 gamma middle domain-containing protein [Dictyostelium discoideum AX4] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PROTEIN === Ce ==== 5e-073     NP_491850.2 MIF4G domain containing protein (92.5 kD) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                  PREDICTED = Sp ==== 4e-111     XP_001187494.1 PREDICTED: similar to Nuclear cap-binding protein subunit 1 (80 kDa nuclear cap-binding protein) (NCBP 80 kDa subunit) (CBP80), partial [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                    PROTEIN -== Ag ==== 2e-120     XP_321964.4 AGAP001195-PA [Anopheles gambiae str. PEST] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PROTEIN === Dm ==== 7e-123     NP_524750.2 cap binding protein 80 CG7035-PB [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PREDICTED = Bt ==== 3e-172     NP_001096008.1 hypothetical protein LOC100124428 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PROTEIN === Mm ==== 6e-178     NP_001028373.2 nuclear cap binding protein subunit 1, 80kDa [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PROTEIN === Hs ==== 2e-179     NP_002477.1 nuclear cap binding protein subunit 1, 80kDa; nuclear cap binding protein, 80kD;nuclear cap binding protein 1, 80kD; nuclear cap binding protein subunit 1, 80kD[Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PREDICTED = Cf ==== 1e-179     XP_867109.1 PREDICTED: similar to 80 kDa nuclear cap binding protein (NCBP 80 kDa subunit) (CBP80) isoform 4 [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PROTEIN === Gg ==== 4e-180     NP_001026611.1 nuclear cap binding protein subunit 1, 80kDa [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PROTEIN === Xt ==== 0          CAJ83816.1 nuclear cap binding protein subunit 1, 80kDa [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                       PROTEIN === Xl ==== 0          NP_001085472.1 MGC80159 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl325o19.5                                                  TGA---------------------TGA------------TGA---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------TAA---------------------------------------------------TGA------------------------------------------TGA---------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Emb4 5g                         IMAGE:4970320.5p ATTCGTCGACCCACGCGTCCGTCACGCGACTATCTCACGCTTGGCTTTGTGAGTAGCTGCCGGTCCCTGCCGGTGACACTGTGTTGTTTGAGGCAAAGTATTGCTCAGCGCCATGTCCAGGAGGAGGCACAGTGACGAGAATGATGGAGGACAACCTCACAAAAGGCGAAGAACCTCTGAACCCCTTGAGATCGAAGACCGATTGGAATCTTTGATATGCAGAGTTGGTGAAAAGAGTACATCCTCACTAGAGAGCAACCTAGAAGGTCTGGCTGGAGTTTTAGAAGCTGATCTGCCTAACTATAAAAACAAGATCTTAAGAATCCTTTGTTTTGTCGCTCGGTTGCTGCCTGAAAAAATGACTGTATACACTACATTAGTTGGGTTACTTAATGCCAGAAACTACAATTTTGGTGGTGAGTTTGTGGAAGCCATGATACGCCATCTCAAGGAGACCATTAAACTGAATGCTTACAATGAGGCAATATATTTAGTTCGTTTTCTTTGTGATCTTGTAAATTGCCATGTAATCGCAGCCCCATCGATGGTTGCCATGTTTGAAAGCTTTGTTGGGGTCACTCAGGAAGAAGATATTCCCCAGGTGCGAAGTGACTGGTATGTGTATGCAGTTCTTTCTTCACTGCCATGGGTTGGAAAAGAATTGTATGAGAAGAAAGATGTTGAGATGGATCAAATTTTATCCCAAATTGAGGCTTACTTTGAGCAACGGCNAAAGCTCCATCTGTCTATTCTGCAAGTATGGTCAGCAGAANAACA
  5   1   2      seed DMZ  5g3  out                        xl325o19.5p                                                     GTAGCTGCCGGTCCCTGCCGGTGACACTGTGTTGTTTGAGGCAAAGTATTGCTCAGCGCCATGTCCAGGAGGAGGCACAGTGACGAGAATGATGGAGGACAACCTCACAAAAGGCGAAGAACCTCTGAACCCCTTGAGATCGAAGACCGATTGGAATCTTTGATATGCAGAGTTGGTGAAAAGAGTACATCCTCACTAGAGAGCAACCTAGAAGGTCTGGCTGGAGTTTTAGAAGCTGATCTGCCTAACTATAAAAACAAGATCTTAAGAATCCTTTGTTTTGTCGCTCGGTTGCTGCCTGAAAAAATGACTGTATACACTACATTAGTTGGGTTACTTAATGCCAGAAACTACAATTTTGGTGGTGAGTTTGTGGAAGCCATGATACGCCATCTCAAGGAGACCATTAAACTGAATGCTTACAATGAGGCAATATATTTAGTTCGTTTTCTTTGTGATCTTGTAAATTGCCATGTAATCGCAGCCCCATCGATGGTTGCCATGTTTGAAAGCTTTGTTGGGGTCACTCAGGAAGAAGATATTCCCCAGGTGCGAAGTGACTGGTATGTGTATGCAGTTCTTTCTTCACTGCCATGGGTTGGAAAAGAATTGTATGAGAAGAAAGATGTTGAGATGGATCAAATTTTATCCCAAATTGAGGCTTACTTGAAGCAACGGCAAAAGCTCCATCTGTCTATTCTG
  5   1   2       bld DMZ  5x3  out                        xl232k14.5p                                                                                                               CCATGTCCAGGAGGAGGCACAGTGACGAGAATGATGGAGGACAACCTCACAAAAGGCGAAGAACCTCTGAACCCCTTGAGATCGAAGACCGATTGGAATCTTTGATATGCAGAGTTGGTGAAAAGAGTACATCCTCACTAGAGAGCAACCTAGAAGGTCTGGCTGGAGTTTTAGAAGCTGATCTGCCTAACTATAAAAACAAGATCTTAAGAATCCTTTGTTTTGTCGCTCGGTTGCTGCCTGAAAAAATGACTGTATACACTACATTAGTTGGGTTACTTAATGCCAGAAACTACAATTTTGGTGGTGAGTTTGTGGAAGCCATGATACGCCATCTCAAGGAGACCATTAAACTGAATGCTTACAATGAGGCAATATATTTAGTTCGTTTTCTTTGTGATCTTGTAAATTGCCATGTAATCGCAGCCCCATCGATGGTTGCCATGTTTGAAAGCTTTGTTGGGGTCACTCAGGAAGAAGATATTCCCCAGGTGCGAAGTGACTGGTATGTGTATGCAGTTCTTTCTTCA
  5   1   2       bld Egg3                            IMAGE:6323810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCGGGGGAACCTGATACTCATCTCAGGAGACATTAAACTGAATGCTTACAATGAGGCAATATATTTAGTTCGTTTTCTTTGTGATCTTGTAAATTGCCATGTAATCGCAGCCCCATCGATGGTTGCCATGTTTGAAAGCTTTGTTGGGGTCACTCAGGAAGAAGATATTCCCCAGGTGCGAAGTGACTGGTATGTGTATGCAGTTCTTTCTTCACTGCCATGGGTTGGAAAAGAATTGTATGAGAAGAAAGATGTTGAGATGGATCAAATTTTATCCCAAATTGAGGCTTACTTGAAGCAACGGCAAAAGCTCCATCTCTCTATTCTGCAAGTATGGTCAGCAGAAAAACCACACCCACAGGAAGAGTATTTAGACTGCCTGTGGGCCCAAGTACAGAAGCTAAAAAAGGACCGCTGGCAGGAAAGACACATCCAACGTCCATACCTTGCCTTTGACAGTGTTCTGTGTGAAGCTTTGCAGCACAATCTTCCACCATTCACACCACCACCTCATACTGAAGATTCTGTGTACCCAGTGCCAAGAGTAATTTTCAGGATGTTTGATTACACAGATGCACCTGAGGGTCCAGTCATGCCTGGAAGTCATTCTGTAGAGCGCTTTGTTATAGAAGAAAATCTGCACTGTATACTTAAATCACATTGGCGTGAAAAGAAACATGTGCTGCTCAGCTGTTAAGCTACCCCAGAGAAGAACAAAATTTCCCTTGAACTATCACATAGGTTGAGGTGATCTTTTGGAAAGCTGGTTCAGTTACCTTCTCCCCCCACAGATTGACGTCATGTATACTACACTTCTAATCGAACCTTTGCAAAATGCAAACCTGGATCTTTGCCCCCAAGTGGCTTGCACCAACCCTCTGAAATGGGGGTAAACACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)