Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7207488.5                       5 END     3          37       60                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012779531 Xl3.1-IMAGE:8532360.3 - 8 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8532360.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAAATTACTTAAAAGCCTTTGTGACCTTCATGCACTACATGGAATATTCACCAGCTCTGGAGATTTCCTTCAGGATGGGCATCTGTCTGGCCATCAGCTGGAGATGGTCACCGAGGCATACCTTAGCCTCCTGACGCTCATAAGGAGAGATGCTGTTTTGCTGGTTGATGCCTTCGATTACGCGGATCAGCAGCTTCTGTCAGCTCTTGGCAGCTATGATGGCAATGTGTATCACAATCTCCTTGAGTGTGCTCAGAAAAACCCAGATAATAAGAAGGTGAATGCTGTCTTTGAAAATTACCTGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGAACCTCATCCCGATGTTCTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTTAATTATGATGAACACCAAATGTTTCCTGAAGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGGTTGGGGGAAGGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATGTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAAAGAATACAACTTATAATTATATAAAATGCAAATAAATCTGCCTTATGATGGACTCCTGTTTGTTGCATCTTTTT
                                                  Xl3.1-CHK-1012698111                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTACTTAAAAGCCTTTGTGACCTTCATGCACTACATGGAATATTCACCAGCTCTGGAGATTTCCTTCAGGATGGGCATCTGTCTGGCCATCAGCTGGAGATGGTCACCGAGGCATACCTTAGCCTCCTGACGCTCATAAGGAGAGATGCTGTTTTGCTGGTTGATGCCTTCGATTACGCGGATCAGCAGCTTCTGTCAGCTCTTGGCAGCTATGATGGCAATGTGTATCACAATCTCCTTGAGTGTGCTCAGAAAAACCCAGATAATAAGAAGGTGAATGCTGTCTTTGAAAATTACCTGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGAACCTCATCCCGATGTTCTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTTAATTATGATGAACACCAAATGTTTCCTGAAGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGGTTGGGGGAAGGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATGTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAAAGAATACAACTTATAATTATATAAAATGCAAATAAATCTGCCTTATGATGGACTCCTGTTTGTTGCATCTTTTTAAAATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     5     7     5     6     4     6     2     3
                                                                       ...PROTEIN --- Ce ---- 2e-014     NP_510603.1 acyl-CoA oxidase family member (74.9 kD) (XQ454) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 8e-015     NP_523802.1 CG9707-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - At ---- 4e-016     NP_181112.1 acyl-CoA oxidase, putative [Arabidopsis thaliana] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-019     NP_001005933.1 zgc:92584 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-021     XP_001193209.1 PREDICTED: similar to acyl-CoA oxidase type 1 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 2e-026     XP_541826.2 PREDICTED: similar to Acyl-coenzyme A oxidase 2, peroxisomal (Branched-chain acyl-CoA oxidase) (BRCACox) (Trihydroxycoprostanoyl-CoA oxidase) (THCCox) (THCA-CoA oxidase) [Canis familiaris] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 9e-030     NP_001095485.1 acyl-Coenzyme A oxidase 2, branched chain [Bos taurus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 9e-030     NP_444345.1 acyl-Coenzyme A oxidase 2, branched chain [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-032     XP_414406.1 PREDICTED: similar to Acyl-coenzyme A oxidase 2, peroxisomal (Branched-chain acyl-CoA oxidase) (BRCACox) (Trihydroxycoprostanoyl-CoA oxidase) (THCCox) (THCA-CoA oxidase) [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 5e-033     NP_003491.1 acyl-Coenzyme A oxidase 2, branched chain; Peroxisomal branched chain acyl-CoAoxidase [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 4e-056     CAJ83302.1 acyl-Coenzyme A oxidase 2, branched chain [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 3e-060     NP_001084533.1 hypothetical protein LOC414480 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8532360.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------ATGATG------------------------TAA------------------------------------------------------------------------------TAA---------ATG---------------TAGATG------TAA------------------------------------------------------------------TAA---------------------ATG---------------------------------------TAA---------ATGATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                   ]
  3   1   2       bld Lmb1      out                   IMAGE:8532360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACACACCAAGAATTACTCCACCCGAAGTCTATTAAGCCTATCAGCACAGGGCCACAGCTCATGGCTCGCTGCTTAGATGCGCACTGATCAGTTCGATGACATATGATGCGTGGAACAGCACATCCGTGGAGCTGTAAAGGCCTCAATAGCTCATTCACATACATATGTGAAGTTGTTTGCTGATGTAACGGGCTCCTTATCAAGTTCTCTGAAATCAAGAAATTACTTAAAAGCCTTTGTGACCTTCATGCACTACATGGAATATTCACCAGCTCTGGAGATTTCCTTCAGGATGGGCATCTGTCTGGCCATCAGCTGGAGATGGTCACCGAGGCATACCTTAGCCTCCTGACGCTCATAAGGAGAGATGCTGTTTTGCTGGTTGATGCCTTCGATTACGCGGATCAGCAGCTTCTGTCAGCTCTTGGCAGCTATGATGGCAATGTGTATCACAATCTCCTTGAGTGTGCTCAGAAAAACCCAGATAATAAGAAGGTGAATGCCGTCTTTGAAAATTACCTGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGAACCTCATCCCGATGTTCTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTTAATTATGATGAACACCAAATGTTTCCTGAAGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGATTGGGGGAAGGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATGTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAAAGAATACAACTTATAATCATATAAACAGGCCAACTAAACC
  5   1   2       bld Egg1                               PBX0029E06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGTCTATATAAAGGCCTATCAGCACAGGGCCCACAGGCTCATTGCCTCTGCTGCCTTTAAGATGCGCAACCTGGTTCAGTTTGGAATGGAACAATATGATGCGTGGAACAGCACATCCGTGGAGCTTGTAAAGGCCTCAATAGCTCATTCACATTACATTATTGTGAAGTTGTTTGCTGATGTAACGGGCTCCTTATCAAGTTCTCCTGAAATCAAGAAATTACTTAAAAGCCTTTGTGACCTTCATGCACTACATGGAATATTCACCAGCTCTGGAGATTTCCTTCAGGATGGGCATCTGTCTGGCCATCAGCTGGAGATGGTCACCGAGGCATACCTTAGCCTCCTGACGCTCATAAGGAGAGATGCTGTTTTGCTGGTTGATGCCTTCGATTACGCGGATCAGCAGCTTCTGTCAGCTCTTGGCAGCTATGATGGCAATGTGTATCACAATCTCCTTGAGTGTGCTCAGAAAAACCCAGATAATAAGAAGGTGAATGCTGTCTTTGAAAATTACCTGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGAACCTCATCCCGATGTTCTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTT
  5   1   2       bld Kid                             IMAGE:7009006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATGCACTACATGGAATATTCACCAGCTCTGGAGATTTCCTTCAGGATGGGCATCTGTCTGGCCATCAGCTGGAGATGGTCACCGAGGCATACCTTAGCCTCCTGACGCTCATAAGGAGAGATGCTGTTTTGCTGGTTGATGCCTTCGATTACGCGGATCAGCAGCTTCTGTCAGCTCTTGGCAGCTATGATGGCAATGTGTATCACAATCTCCTTGAGTGTGCTCAGAAAAACCCAGATAATAAGAAGGTGAATGCCGTCTTTGAAAATTACCTGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGAACCTCATCCCGATGTTCTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTTAATTATGATGAACACCAAATGTTTCCTGAAGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGGTTGGGGGAAGGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATGTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAANGAATACACTTANTATTTATATAAATGCAAATAAATCTGCCTTATGATGGNaaaaaaaaaaaaaaGG
  3   1   2      seed Ov1  5g3  out                   IMAGE:5073999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCTGACGCTCATAAGGAGAGATGCTGTTTTGCTGGTTGATGCCTTCGATTACGCGGATCAGCAGCTTCTGTCAGCTCTTGGCAGCTATGATGGCAATGTGTATCACAATCTCCTTGAGTGTGCTCAGAAAAACCCAGATAATAAGAAGGTGAATGCTGTCTTTGAAAATTACCTGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGAACCTCATCCCGATGTTCTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTTAATTATGATGAACACCAAATGTTTCCTGAAGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGGTTGGGGGAAGGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATGTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAAAGAATACAACTTATAATTATATAAAATGCAAATAAATCTGCCTTATGATGGAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Egg2                            IMAGE:5162170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCTCTTGGCAGCTATGATGGCAATGTGTATCACAATCTCCTTGAGTGTGCTCAGAAAAACCCAGATAATAAGAAGGTGAATGCTGTCTTTGAAAATTACCTGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGACCCTCATCCCGATGTTCTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTTAATTATGATGAACACCAAATGTTTCCTGAAGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGGTTGGGGGAAGGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATTTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAAAGAATACAACTTATAATTATATAAAATGCAAATAAATCTGCCTTATGATGGACTCCTGTTTGTT
  5   1   2       bld Tad2                            IMAGE:6931862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTATCACAATCTCCTTGAGTGTGCTCAGAAAAACCCAGATAATAAGAAGGTGAATGCTGTCTTTGAAAATTACCTGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGAACCTCATCCCGATGTTCTTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTTAATTATGATGAACACCAAATGTTTCCTGAAGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGGTTGGGGGAAGGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATTTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAAAGAACACAACTTATAATTATATAAAATGCAAATAAATCTGCCTTATGATGGACTCCTGTTTGTTGATCTTTTTAAATTTTGTTGATTTTGTATATAATCACTCATAGACGCTACGaaaaaagaaaaaaaaaTGCCNCTGACTACTTGCGTGAGATCAGATTCACGGACAGATTTN
  3   1   2       bld Neu7      out                        XL016l06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAGCCACATTTACAAAGCAATATATCAAAACTATAAAGAGAACCTCATCCCGATGTTCTTTTTTGCCTAACCCATAAAGCACTGGGATATGTGAGTGTTGCCTTAATTATGATGAACACCAAATGTTTCCTGAAGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGATTGGGGGAAGGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATGTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAAAGAATACAACTTATAATTATATAAAATGCAAATAAATCTGCCTTATGATGGACTCCTGTTTGTTGCATCTTTTTAAAATTTTTGTnATTTTTTGTTATAATAAATACAACAGTCAATAAAGAAACAGCATT
  3   1   2       bld Egg6                            IMAGE:4412612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCTTAACTTACATCCTGCCAATTTATATTTGCACTTAAACTATTCTACTATAAACTGTTCGATGCCTGGCCTCCTTCTGGGGCATAATTCATAGAAATGCAGGTTGGGGGAAGTAGATGCCAAAATAACAACCCCCAGCGTTCCCTCCATCCAACTTCAGCCTTTGTAATGTGATTTTACAAAAATGTTGGTTTTAATTATTTTGCTGTCTTCATAGAATGAGTGTAAAGAATACAACTTATAATTATATAAAATGCAAATAAATCTGCCTTATGATGGACTCCTGTTTGTTGCATCTTTTTAAAATTTTTGTTGATTTTTTGTTATAATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)