Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8740930.3                       5 END     3          27       60                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8740436.3                      11 PI      90        165     1308                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012779779 Xl3.1-IMAGE:8741159.5 - 11 ESTs
                                                                       .....-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8741159.5                                                                                                ACTGGTGGGGGTGAAGCTACTGGTGGATTACAGTAAAACTCCCATTTTGGAATTGGTAGGAAACTTAAGTGGTTATGGGTTAAACTATGTGCCACTTATAACTGGCAGAATAGCTACAAATAATGTTCAGGTATTGTAAAGGGCTCAACATTAGAAGAACAAAAGAAGAATACTAAAATGGGTTTCATTCAGCTGTAGTTATACCACAATAGCAAAGGACTCAAATAGAATAGAATTTCTTAAAGAAGTCTAAGTGTTATCCCCTCAGCTGAGAGCCAGACATGATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCACATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGATCCAACTGCCACCAACCTGCACCTCACAGAATATGAATCAGTACAAAATGTAACCTTTTTCGCTCATCTATAAACAGACAACACTCCCAAAGAACCAAGGGACCCCACCCAAGTGCGAATCTGATGCTCGCCCCTGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAACTGCCCCCTTCCCCTGACCCTCATTCAACCCATTTGTCCTCCCTTGCCATACTCATTTTTTTATCCCAAGCCAAGAGGATAATCTATGAAAAAGTTTTAGCAAAGGGAATAAACCCTTTCCTGTCTCCATCTCATCTCAAGAGCTTTCCATCTTTGGTACTATATGTAAATGAGTACTGAGTATGTCTATACACTCTTCATGTCCTGCTGAACTATTACATTGGCTGCCCATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGGGGTTTCAGAGGCCACAGGGACACAGCACAATGTCGGTGGGGTATACTTGGC
                                                  Xl3.1-CHK-1012694350                                                                                                      GGGGGTGAAGCTACTGGTGGATTACAGTAAAACTCCCATTTTGGAATTGGTAGGAAACTTAAGTGGTTATGGGTTAAACTATGTGCCACTTATAACTGGCAGAATAGCTACAAATAATGTTCAGGTATTGTAAAGGGCTCAACATTAGAAGAACAAAAGAAGAATACTAAAATGGGTTTCATTCAGCTGTAGTTATACCACAATAGCAAAGGACTCAAATAGAATAGAATTTCTTAAAGAAGTCTAAGTGTTATCCCCTCAGCTGAGAGCCAGACATGATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCACATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGATCCAACTGCCACCAACCTGCACCTCACAGAATATGAATCAGTACAAAATGTAACCTTTTTCGCTCATCTATAAACAGACAACACTCCCAAAGAACCAAGGGACCCCACCCAAGTGCGAATCTGATGCTCGCCCCTGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAACTGCCCCCTTCCCCTGACCCTCATTCAACCCATTTGTCCTCCCTTGCCATACTCATTTTTTTATCCCAAGCCAAGAGGATAATCTATGAAAAAGTTTTAGCAAAGGGAATAAACCCTTTCCTGTCTCCATCTCATCTCAAGAGCTTTCCATCTTTGGTACTATATGTAAATGAGTACTGAGTATGTCTATACACTCTTCATGTCCTGCTGAACTATTACATTGGCTGCCCATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGGGGTTTCAGAGGCCACAGGGACACAGCACAATGTCGGTGGGGTATACTTGGCAAGGCT
                                                      consensus depths                                                                                                     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     9     6     9     6     9     5     8     5     8     5     8     6     8     6     8     6     8     6     8     5     8     6     8     6     8     6     8     7     9     7     9     6     9     5     9     5     9     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5     9     5     8     5     8     5     8     5     8     5     8     5     8     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     3     5     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     287     148                                                                                                
                                               BLH MIN     287      38                                                                                                
                                               BLH OVR     284     341                                                                                                
                                               ORF LNG     284      15                                                                                                
  5   1   2       bld Emb4 5x3                        IMAGE:5537499.5p ACTCTCTGGGTGCAATCTCTCAGGACAAccccccccccccccGGTGCCCAGCCCATGGACTCGGAAAAGTGAAACTTTGTCTGAGGGGTGAAGCTACTGGTGGGGGTGAAGCTACTGGTGGATTACAGTAAAACTCCCATTTTGGAATTGGTAGGAAACTTAAGTGGTTATGGGTTAAACTATGTGCCACTTATAACTGGCAGAATAGCTACAAATAATGTTCAGGTATTGTAAAGGGCTCAACATTAGAAGAACAAAAGAAGAATACTAAAATGGGTTTCATTCAGCTGTAGTTATACCACAATAGCAAAGGACTCAAATAGAATAGAATTTCTTAAAGAAGTCTAAGTGTTATCCCCTCAGCTGAGAGCCAGACATGATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCACATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGGATGAGCAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGGATAATGAGGGACCTTTTAAATAAAGGGGAACTGGCAGAAAACCGAAAGACCTGGGAAGGGAAAACCCCAAATTAACCTGAAAGATTGCTTGGACTGGCCATCCAAAGGAATTACCACTTCAAGGGACAAAGCTACCTGAGTGTTGGATCCCAACTGGCCCACCAAACCTGGCCCCCTTCACCGAAATTATGAAATTCCGTTACCCAAAGGGGGAAGCCCTTTTTTCGC
  5   1   2      seed Emb4 5g3  out                   IMAGE:4203908.5p                                                                                    CATGGTGAAGCTACTGGTGGGGGTGAAGCTACTGGTGGATTACAGTAAAACTCCCATTTTGGAATTGGTAGGAAACTTAAGTGGTTATGGGTTAAACTATGTGCCACTTATAACTGGCAGAATAGCTACAAATAATGTTCAGGTATTGTAAAGGGCTCAACATTAGAAGAACAAAAGAAGAATACTAAAATGGGTTTCATTCAGCTGTAGTTATACCACAATAGCAAAGGACTCAAATAGAATAGAATTTCTTAAAGAAGTCTAAGTGTTATCCCCTCAGCTGAGAGCCAGACATGATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCACATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGGTT
  5   1   2       bld Tail 5g3  out                   IMAGE:8542343.5p                                                                                        GGTGAACTACTGGTGGGGGTGAAGCTACTGGTGGATTACAGTAAAACTCCCATTTTGGAATTGGTAGGAAACTTAAGTGGTTATGGGTTAAACTATGTGCCACTTATAACTGGCAGAATAGCTACAAATAATGTTCAGGTATTGTAAAGGGCTCAACATTAGAAGAACAAAAGAAGAATACTAAAATGGGTTTCATTCAGCTGTAGTTATACCACAATAGCAAAGGACTCAAATAGAATAGAATTTCTTAAAGAAGTCTAAGTGTTATCCCCTCAGCTGAGAGCCAGACATGATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCACATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCNAGACCACAGATTTANGGGATATGAGGACTTTTTATAGAGGGGAACTGCANGAACAGAAGACCTGGAAGTGAACCCAAATTACTGAGTAGCTGTACTGCTCGAGAGCAAAGACGAATGACCTGTCAATCAAGTCGCAAGGAAAAGGGGCCAATGTGACGACGGCACACGGGCACA
  5   1   2       bld Bone      in                    IMAGE:8739541.5p                                                                                              CTACTGGTGGGGGTGAAGCTACTGGTGGATTACAGTAAAACTCCCATTTTGGAATTGGTAGGAAACTTAAGTGGTTATGGGTTAAACTATGTGCCACTTATAACTGGCAGAATAGCTACAAATAATGTTCAGGTATTGTAAAGGGCTCAACATTAGAAGAACAAAAGAAGAATACTAAAATGGGTTTCATTCAGCTGTAGTTATACCACAATAGCAAAGGACTCAAATAGAATAGAATTTCTTAAAGAAGTCTAAGTGTTATCCCCTCAGCTGAGAGCCAGACATGATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCACATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGAATGAAGTCCCAGATATTCCTGGGGAACAGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAGATAGTCCGAAGTCTACGCAGAGTGGGTCCACCAGGACCACAGATTTAGGGATAATGAGGACTTTTAATAGAGGGACACTGCAGACGAGAACTTGAAGTGAACCCCATACCTGAGAGCTGTACTGCATCGAGCAAGACAAAATGACCTGTCCATCAGTCCACGGGGAGTTCCATGGACAGCGCACGGTCCATTAACCAACTGAACCGAATG
  5   1   2       bld Bone 5g                         IMAGE:8741159.5p                                                                                                                                                           GAAACTTAAGTGGTTATGGGTTAAACTATGTGCCACTTATAACTGGCAGAATAGCTACAAATAATGTTCAGGTATTGTAAAGGGCTCAACATTAGAAGAACAAAAGAAGAATACTAAAATGGGTTTCATTCAGCTGTAGTTATACCACAATAGCAAAGGACTCAAATAGAATAGAATTTCTTAAAGAAGTCTAAGTGTTATCCCCTCAGCTGAGAGCCAGACATGATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCTCATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCACGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGGCAGAGACGAAAATGACACTGTCAGATCAGAGTCGCAGACGGAGAAAGGTGCACAGATTGTGAACGAGCGCACAACGGGTGCACAGTGAAACGCAAACTGGGAACCCAAATATGGAACGCCAGATACCTCAGTACAAGCTACTGATGCTGATCAACT
  3   1   2       bld Bone      in                    IMAGE:8739541.3p                                                                                                                                                                                                                                             TGAAGAGTCCAGGAACATGAATGGGGGTTCTGAACAAGAGCCTGGGGTGGCATAGTGCTGATAGATCTTGTGTGAGCGGTCAGGATGTAGTGCACATGTTCGGGGAGCTGTAAATTGTTCTCGCCGACTCCATCCGAGCTGACAAAGAACTTGTGAGAGTGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGGCAGAGGACGAAAATGACACTGTCAGATCAGAGGTCGCAGACGGGAGAAAGGGTGCACAGATTGTGAAACGAGCCGGCACCAAACGGGTGCAACAGTGAAACGCAAAACTGGGACACCCCAAATAATGGGAAACGCCCAGAATTACACTTCAAGTACAAGCTACTGATGCTGATCCAACTGCCACCAACCTGCACCTCACAGAATATGAATCAGTACAAAATGTAACCTTTTTCGCTCATCTATAAACAGACAACACTCCCAAAGAACCAAGGGACCCCACCCAAGTGCGAATCTGATGCTCGCCCCTGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAACTGCCCCCTTCCCCTGACCCTCATTCAACCCATTTGTCCTCCCTTGCCATACTCATTTTTTTATCCCAAGCCAAGAGGATAATCTATGAAAAAGTTTTATAAAGGGATTAAACG
  5   1   2       bld Bone      out                   IMAGE:8740930.5p                                                                                                                                                                                                                                                                                                                                                                                                     TTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCTCATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGGCAGAGGACGAAAATGACACTGTCAGATCAGAGGTCGCAGACGGGAGAAAGGGTGCACAGATTGTGAAACGAGCCGGCACCAAACGGGTGCAACAGTGAAACGCAAAACTGGGACACCCCAAATAATGGGAAACGCCCAGAATTACACTTCAAGTACAAGCTACTGATGCTGATCCAACTGCCACCAACCTGCACCTCACAGAATATGAATCAGTACAAAATGTAACCTTTTTCGCTCATCTATAAACAGACACACTCCCAAAGAACCAAAGGGACCCCACCCAAGTGCGAATCTGATGCTCGCCCCTGTATGCTCACGGCATGAGACTTGCACCCTGCTGTTACAATGTATATGCATGTGATGACATTTGGGGAGTGGAGAGACTGCCCCACGCTTGAACCTTCATCCATCATTGTCTCCTGCATACTCATTTTTTTATTCCAAGCCAGA
  5   1   2       bld Tail                            IMAGE:8545600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         AAANNNNCCATCGCGTTNGNGAAGAGTACTACATAATATTCGTCCCCTCACTCCCTTCATGACAATGGTGCCCCTCTGACATATGGAGAGCTTCATCCTACCTTCAAGGGTAGTAAAACAATCCAAGTTTCACAGCAAAGTACAATATACACTGGAAGAGGACTTGGACAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCACCAACCTGCACCTCACAGAATATGAATCAGTACAAAATGTAACCTTTTTCGCTCATCTATAAACAGACAACACTCCCAAAGAACCGAGGGACCCCACCCAAGTGCGAATCTGATGCTCGCCCCTGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAACTGCCCCCTTCCCCTGACCCTCATTCAACCCATTTGTCCTCCCTCGCCATACTCATTTTTTTAACCCAAGCCAAGAGGATAATCTATGAAAAAGTTTTAGA
  5   1   2       bld Thy                             IMAGE:8551053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCCTACCTTCAAGGGTAGTAAAACAATCCAAGTTTCACAGCAAAGTACAATATACACTGGAAGAGGACTTGGACAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGATCCAACTGCCACCAACCTGCACCTCACAGAATATGAATCAGTACAAAATGTAACCTTTTTCGCTCATCTATAAACAGACAACACTCCCAAAGAACCAAGGGACCCCACCCAAGTGCGAATCTGATGCTCGCCCCTGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAACTGCCCCCTTCCCCTGACCCTCATTCAACCCATTTGTCCTCCCTTGCCATACTCATTTTTTTATCCCAAGCCAAGAGGATAATCTATGAAAAAGTTTTAGCAAAGGGAATAACCCTTTCCTGTTCCATCTCATCTCAGAGCTTTCATCTTGGTACTATATGTAATGAGTACTGATAGTCTATCCTCTTCTGTCTGCTGACTATACATGCTGCCATCACACACATACAGTACCTAGCTTGTGGGTTCGAGCCCG
  5   1   2       bld Lmb1                            IMAGE:8534125.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAGGTTCACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGATCCAACTGCCACCAACCTGCACCTCACAGAATATGAATCAGTACAAAATGTAACCTTTTTCGCTCATCTATAAACAGACAACACTCCCAAAGAACCAAGGGACCCCACCCAAGTGCGAATCTGATGCTCGCCCCTGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAACTGCCCCCTTCCCCTGACCCTCATTCAACCCATTTGTCCTCCCTTGCCATACTCATTTTTTTATCCCAAGCCAAGAGGATAATCTATGAAAAAGTTTTAGCAAAGGGAATAAACCCTTTCCTGTCTCCATCTCATCTCAAGAGCTTTCCATCTTTGGTACTATATGTAAATGAGTACTGAGTATGTCTATACACTCTTCATGTCCTGCTGAACTATTACATTGGCTGCCCATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGGGGTTTCAGAGGCCACAGGGACACAGCACAATGTCNGTGGGGTATACTTGGCAAGGCTTTCTGCTATCATANGGCATTTTTGCTTGGTTCCTCTGAAGCAAANGGCT
  5   1   2       bld Kid                             IMAGE:7007932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCACAGATTGTGAAACGAGCCGGCACCAAACGGGTGCAACAGTGAAACGCAAAACTGGGACACCCCAAATAATGGGAAACGCCCAGAATTACACTTCAAGTACAAGCTACTGATGCTGATCCAACTGCCACCAACCTGCACCTCACAGAATATGAATCAGTACAAAATGTAACCTTTTTCGCTCATCTATAAACAGACAACACTCCCAAAGAACCAAGGGACCCCACCCAAGTGCGAATCTGATGCTCGCCCCTGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAACTGCCCCCTTCCCCTGACCCTCATTCAACCCATTTGTCCTCCCTTGCCATACTCATTTTTTTATCCCAAGCCAAGAGGATAATCTATGAAAAAGTTTTAGCAAAGGGAATAAACCCTTTCCTGTCTCCATCTCATCTCAAGAGCTTTCCATCTTTGGTACTATATGTAAATGAGTACTGAGTATGTCTATACACTCTTCATGTCCTGCTGAACTATTACATTGGCTGCCCATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGGGGTTTCAGAGGCCACAGGGACACAGCACAATGTCGGTGGGGTATACTTGGCAAGGCTTCTGCTTATCATAGGGCATTTTTGCTTGGTTTCCTCTGAAGCANAAGGGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)