Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6631436.5                      16 PI      94         53      768                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012779796 Xl3.1-IMAGE:7211648.5 - 5 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7211648.5                             CCCCATGACAGGGTGTCACTTCCGCTGGCAAGAGAAGGGTTGGCAGGGGTAGGAAGCGGAGACGAGAAGCTGGCCCGGCGTATACTACCAGACCGGCCCGGGATATCCAGACGCGTCAACGACCCACCCGTAACTGTTCTAAAAGATGACGTCCAGGAAGAAAGTGCTGCTGAAGGTCATCATCCTCGGGGATTCTGGGGTTGGCAAGACCTCTCTCATGAACCAGTATGTGAATAAGAAGTTCACCAACCAGTACAAAGCCACTATAGGGGCAGATTTTCTCACTAAGGAGGTGATGGTGGATGACAGATTGGTCACAATGCAGATCTGGGACACAGCTGGGCAGGAAAGGTTCCAATCCCTGGGGGTCGCTTTCTACCGAGGGGCCGACTGCTGCGTGTTGGTCTACGACGTCACGGCTCCCAACACTTTCAAGACTCTGGACAGTTGGAGAGATGAATTCCTCATCCAGGCGAGTCCAAGGGATCCGGAGAACTTTCCGTTTGTTGTGCTGGGAAATAAGGTAGACCTTGAGAACAGACAAGTAACCACAAAGCGAGCACAGGTGTGGTGCCATAGCAAAAACAACATCCCATATTTTGAAACCAGTGCAAAGGAAGCTATCAATGTGGAACAGGCTTTTCAGACGATCGCACGGAATGCACTTAAACAGGAGACCGAGGTGGAGCTGTACAACGAATTCCCAGAACCCATCAAATTGGACAAAAATGACAGAGCAAAGGCCTCTGCTGAGAGCTGCAGCTGCTG
                                                  Xl3.1-CHK-1012704829                                   GACAGGGTGTCACTTCCGCTGGCAAGAGAAGGGTTGGCAGGGGTAGGAAGCGGAGACGAGAAGCTGGCCCGGCGTATACTACCAGACCGGCCCGGGATATCCAGACGCGTCAACGACCCACCCGTAACTGTTCTAAAAGATGACGTCCAGGAAGAAAGTGCTGCTGAAGGTCATCATCCTCGGGGATTCTGGGGTTGGCAAGACCTCTCTCATGAACCAGTATGTGAATAAGAAGTTCACCAACCAGTACAAAGCCACTATAGGGGCAGATTTTCTCACTAAGGAGGTGATGGTGGATGACAGATTGGTCACAATGCAGATCTGGGACACAGCTGGGCAGGAAAGGTTCCAATCCCTGGGGGTCGCTTTCTACCGAGGGGCCGACTGCTGCGTGTTGGTCTACGACGTCACGGCTCCCAACACTTTCAAGACTCTGGACAGTTGGAGAGATGAATTCCTCATCCAGGCGAGTCCAAGGGATCCGGAGAACTTTCCGTTTGTTGTGCTGGGAAATAAGGTAGACCTTGAGAACAGACAAGTAACCACAAAGCGAGCACAGGTGTGGTGCCATAGCAAAAACAACATCCCATATTTTGAAACCAGTGCAAAGGAAGCTATCAATGTGGAACAGGCTTTTCAGACGATCGCACGGAATGCACTTAAACAGGAGACCGAGGTGGAGCTGTACAACGAATTCCCAGAACCCATCAAATTGGACAAAAATGACAGAGCAAAGGCCTCTGCTGAGAGCTGCAG
                                                      consensus depths                                  2     2     2     2     2     3     2     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     3     5     2     4     2     4     2     4     2     4     2     4
                                               BLH ATG     137    1321                             
                                               BLH MIN     137     147                             
                                               BLH MPR     134     147                             
                                               BLH OVR     137    1300                             
                                               CDS MIN     137     147                             
                                               ORF LNG     137      37                             
  5   1   2       bld Kid  5g                         IMAGE:4030853.5p AATTAGGAGGAGGCGTTGACGTCAGGCGCCCCATGACAGGGTGTCACTTCCGCTGGCAAGAGAAGGGTTGGCAGGGGTAGGAAGCGGAGACGAGAAGCTGGCCCGGCGTATACTACCAGACCGGCCCGGGATATCCAGACGCGTCAACGACCCACCCGTAACTGTTCTAAAAGATGACGTCCAGGAAGAAAGTGCTGCTGAAGGTCATCATCCTCGGGGATTCTGGGGTTGGCAAGACCTCTCTCATGAACCAGTATGTGAATAAGAAGTTCACCAACCAGTACAAAGCCACTATAGGGGCAGATTTTCTCACTAAGGAGGTGATGGTGGATGACAGATTGGTCACAATGCAGATCTGGGACACAGCTGGGCAGGAAAGGTTCCAATCCCTGGGGGTCGCTTTCTACCGAGGGGCCGACTGCTGCGTGTTGGTCTACGACGTCACGGCTCCCAACACTTTCAAGACTCTGGACAGTTGGAGAGATGAATTCCTCATCCAGGCGAGTCCAAGGGACCCGGAGAACTTTCCGTTTGTTGTGCTGGGAAATAAGGTAGACCTTGAGAACAGACAAGTAACCACAAAGCGAGCACAGGTGTGGTGCCATAGCAAAAACAACATCCCATATTTTGAAACCAGTGCAAAGGGAGCTATCAATGTGGAACAGGCTTTTCAGACGATCGCACGGAATGCACTTAAACAGGAGACCGAGGTGGAGCTGTACAACGAATTCCCCAGAACCCATCAAATTGGGACAAAAATGACAGAGCAAAAGGCCTCTGGCCTGAGAGCCTGCAGCCTGCTGAAAAGCGGAAAGGTGGCCCGGAGTTCTTCTCACCTAACCCGATAATCACAAC
  5   1   2       bld Ov1  5g                         IMAGE:8329866.5p                 CCCACGCGTCCGCCCCATGACAGGGTGTCACTTCCGCTGGCAAGAGAAGGGTTGGCAGGGGTAGGAAGCGGAGACGAGAAGCTGGCCCGGCGTATACTACCAGACCGGCCCGGGATATCCAGACGCGTCAACGACCCACCCGTAACTGTTCTAAAAGATGACGTCCAGGAAGAAAGTGCTGCTGAAGGTCATCATCCTCGGGGATTCTGGGGTTGGCAAGACCTCTCTCATGAACCAGTATGTGAATAAGAAGTTCACCAACCAGTACAAAGCCACTATAGGGGCAGATTTTCTCACTAAGGAGGTGATGGTGGATGACAGATTGGTCACAATGCAGATCTGGGACACAGCTGGGCAGGAAAGGTTCCAATCCCTGGGGGTCGCTTTCTACCGAGGGGCCGACTGCTGCGTGTTGGTCTACGACGTCACGGCTCCCAACACTTTCAAGACTCTGGACAGTTGGAGAGATGAATTCCTCATCCAGGCGAGTCCAAGGGATCCGGAGAACTTTCCGTTTGTTGTGCTGGGAAATAAGGTAGACCTTGAGAACAGACAAGTAACCACAAAGCGAGCACAGGTGTGGTGCCATAGCANNAACAACATCTCATATTTTGAAACCAGTGCAAAGGAAGCTATCAATGTGGAACAGGCTTTTCAGACGATCGCACGGAATGCACTTAAACAAGAGACCGAGGTGGAGCTGTACAACGAATTCTCAGAAACCATCA
  5   1   2      seed Te2  5g                         IMAGE:7211648.5p                                                  TACCCGGGAATTTNCCCGGGATCAGGGGTAGGAAGCGGAGACGAGAAGCTGGCCCGGCGTATACTACCAGACCGGCCCGGGATATCCAGACGCGTCAACGACCCACCCGTAACTGTTCTAAAAGATGACGTCCAGGAAGAAAGTGCTGCTGAAGGTCATCATCCTCGGGGATTCTGGGGTTGGCAAGACCTCTCTCATGAACCAGTATGTGAATAAGAAGTTCACCAACCAGTACAAAGCCACTATAGGGGCAGATTTTCTCACTAAGGAGGTGATGGTGGATGACAGATTGGTCACAATGCAGATCTGGGACACAGCTGGGCAGGAAAGGTTCCAATCCCTGGGGGTCGCTTTCTACCGAGGGGCCGACTGCTGCGTGTTGGTCTACGACGTCACGGCTCCCAACACTTTCAAGACTCTGGACAGTTGGAGAGATGAATTCCTCATCCAGGCGAGTCCAAGGGATCCGGAGAACTTTCCGTTTGTTGTGCTGGGAAATAAGGTAGACCTTGAGAACAGACAAGTAACCACAAAGCGAGCACAGGTGTGGTGCCATAGCAAAAACAACATCCCATATTTTGAAACCAGTGCAAAGGAAGCTATCAATGTGGAACAGGCTTTTCAGACGATCGCACGGAATGCACTTAAACAGGAGACCGAGGTGGAGCTGTACAACGAATTCCCAGAACCCATCAAATTGGACAAAAATGACAGAGCAAAGGCCTCTGCTGAGAGCTGCAGCTGCTGAAAGCGAAAGTTGCCGGAGTCTCTCACTAACCGATATCACACTTANGCCTTCGAACACAAGAGCCCCTTCCCTNCCCTGTCAGAGTGTAAAGGAAANTAATAATCATCTGCATCATCTCCAGCTCCCAGAATCGATCCAATTGGATCTGACCCTGTTCTACGCCAAACATGTTTCCTCAtttttttttttttgtgtggggggggggg
  5   1   2       bld Te1  5g                         IMAGE:6929242.5p                                                                                         GGGGAGAAGCTGGCCCGGCGTATACTACCAGACCGGCCCGGGATATCCAGACGCGTCAACGACCCACCCGTAACTGTTCTAAAAGATGACGTCCAGGAAGAAAGTGCTGCTGAAGGTCATCATCCTCGGGGATTCTGGGGTTGGCAAGACCTCTCTCATGAACCGGTATGTGAATAAGAAGTTCACCAACCAGTACAAAGCCACTATAGGGGCAGATTTTCTCACTAAGGAGGTGATGGTGGATGACAGATTGGTCACAATGCAGATCTGGGACACAGCTGGGCAGGAAAGGTTCCAATCCCTGGGGGTCGCTTTCTACCGAGGGGCCGACTGCTGCGTGTTGGTCTACGACGTCACGGCTCCCAACACTTTCAAGACTCTGGACAGTTGGAGAGATGAATTCCTCATCCAGGCGAGTCCAAGGGATCCGGAGAACTTTCCGTTTGTTGTGCTGGGAAATAAGGTAGACCTTGAGAACAGACAAGTAACCACAAAGCGAGCACAGGTGTGGTGCCATAGCAAAAACAACATCCCATATTTTGAAACCAGTGCAAAGGAAGCTATCAATGTGGAACAGGCTTTTCAGACGATCGCACGGAATGCACTTAAACAGGAGACCGAAGTGGGAGCTGTACAACGAATTTCCCAGAACCATTCAAATTGGGACCAAAAATGGACCGAGCCAAAGGGCCTCCTGCCTGAGAAGCTGCCAGCTTGGCTGAAAAAGCCGAAAGGGTTGCCCCGGAGAGTCCTCT
  5   1   2       add Ga18                               xlk58h21ex.5p                                                                                                                                                                                                                                                                                                                                                                                         GAAAGGNTCCAATCCCTGGGNTCGCTTTCTACCGAGGGGCCGACTGCTGCGTGTTGGTCTACGACGTCACGGCTCCCAACACTTTCAAGACTCTGGACAGTTGGAGAGATGAATTCCTCATCCAGGCGAGTCCAANNNNNNGGAGAACTTTCCGTTTGTTGTGCTGGGAAATAAGGTAGACCTTGAGAACAGACAAGTAACCACAAAGCGAGCACAGGTGTGGTGCCATAGCAAAAACAACATCCCATATTTTGAAACCAGTGCAAAGGAAGCTATCAATGTGGAACAGGCTTTTCAGACGATCGCACGGAATGCACTTAAACAGGAGACCGAGGTGGAGCTGTACAACGAATTCCCAGAACCCATCAAATTGGACAAAAATGACAGAGCAAAGGNCTCTGCTGAGAGCTGCAGCTGCTGNNNNNNATGTTGCCGGAGTCTCTCACTCACCGATATCACACTTAGGCCTTCGAACACGAGCCCCTTCCCTCCCTGTCCAGAGTGTAAAGGATAAATATTAATCATCTGCATCATCTCCAGCTCCCAGACATCGATCCAATTGGATACTGACACCTGTATCATACGCACAACACAATGGTTTTTCTCATCAAGttttttttCNGNNNG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)