Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL032e20.3                            8 END     6         100       75                cyclase associated protein 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012780162 Xl3.1-XL054e18.5 - 6 ESTs
                                                                       ..-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL054e18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCCTCTCCTGCACAACTGACACATTGCGCACAGGCGCCTGAGTATCGGCCCCTCATTGCTGCCCAATTTCTCTGCATTTTTACCTCACGCGTCTGCTTCATTTTGATACTAAACCCGCGCCCACAACAACACGAGCAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTAATTCGACTTGAATGTGTGCTTTCAAGTTCTTATTCTTCCAACTCAGCAGACAAAAATGTTGTTAATGGCATAAATGGAGGTGTTGCCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCAGGGACATTGGAGGAATATCTCAAGAATAGCAAAGTTATTGGCGGTGAAGTAGAGGCACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAGCATTTCTGGTTTTCGCTTCGCAACACCAGCAGCCCCCTCAGGTGGAGGAGTCCTTAATCCTAAAGCCAATTTCTGAAAGAATCCTTGAAGTACAGTTATTCAGAGAAAAAAATCGTGGAAGTCAAATGTTCAACCACCTTTCTGCCATCAGTGAAAGTGTACCAGCACTTGGTTGGATTGCCATGTCGCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCAACACCATGTGGATTGGGTCAAATCTTACTTGAATATATGGAGCGAGCTGCAAGCGTACATTAAGGAATATCACACCACAGGAGTTTCATGGGGAAATGCTATATATTCAATTCCACCAACTGCCAATGGAGGCACTCTACTGCAAAAA
                                                  Xl3.1-CHK-1012703086                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCTGCACAACTGACACATTGCGCACAGGCGCCTGAGTATCGGCCCCTCATTGCTGCCCAATTTCTCTGCATTTTTACCTCACGCGTCTGCTTCATTTTGATACTAAACCCGCGCCCACAACAACACGAGCAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTAATTCGACTTGAATGTGTGCTTTCAAGTTCTTATTCTTCCAACTCAGCAGACAAAAATGTTGTTAATGGCATAAATGGAGGTGTTGCCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCAGGGACATTGGAGGAATATCTCAAGAATAGCAAAGTTATTGGCGGTGAAGTAGAGGCACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAGCATTTCTGGTTTTCGCTTCGCAACACCAGCAGCCCCCTCAGGTGGAGGAGTCCTTAATCCTAAAGCCAATTTCTGAAAGAATCCTTGAAGTACAGTTATTCAGAGAAAAAAATCGTGGAAGTCAAATGTTCAACCACCTTTCTGCCATCAGTGAAAGTGTACCAGCACTTGGTTGGATTGCCATGTCGCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCAACACCATGTGGATTGGGTCAAATCTTACTTGAATATATGGAGCGAGCTGCAAGCGTACATTAAGGAATATCACACCACAGGAGTTTCATGGGGAAATGCTATATATTCAATTCCACCAACTGCCAATGGAGGCACTCTACTGCAAAAATCATCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     153     645                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     153      91                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     153    1042                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     153      43                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 9e-030     XP_001196053.1 PREDICTED: similar to adenylyl cyclase-associated protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Ce ==== 6e-032     NP_510713.1 adenylyl Cyclase ASsociated protein Homolog (53.0 kD) (cas-1) [Caenorhabditiselegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- ?? ---- 6e-039     XP_636512.1 cyclase associated protein [Dictyostelium discoideum AX4] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 5e-046     NP_001033870.1 capulet CG33979-PB, isoform B [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Ag ---- 7e-047     XP_319349.4 AGAP010175-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 2e-064     NP_957130.1 hypothetical protein MGC73317 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 2e-064     CAJ83646.1 CAP, adenylate cyclase-associated protein 1 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 7e-078     NP_006357.1 adenylyl cyclase-associated protein 2 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 3e-078     NP_080332.1 CAP, adenylate cyclase-associated protein, 2 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bt ==== 2e-080     NP_001092449.1 CAP, adenylate cyclase-associated protein, 2 [Bos taurus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Gg ==== 3e-081     XP_418936.2 PREDICTED: hypothetical protein [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Cf ==== 4e-081     XP_535897.2 PREDICTED: similar to adenylyl cyclase-associated protein 2 isoform 1 [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 1e-129     NP_001085243.1 cyclase associated protein 2 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL054e18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGA------------------------------------------------------------------------------------TGA---TAA---------------------------------------ATG------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Ga12 5g3  out                        XL143h05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAAAAGCTGGAGAGATGCCTATCTAGCTAGGCTCTGGCATTGCAATATTACTGGCAAATTACGGGAGGCTGCCTCTGTCCATCTCGCTCTCCATCCCTTCTCCTTCTCCCCACCCCTTCTGCCATTTCCCTCAGTCTCCTTCCCTCAGGGAGACTTCTCTTTATTAGGAGATCCGGGAAGCGGAGACTCCTCTCCTGCACAACTGACACATTGCGCACAGGCGCCTGAGTATCGGCCCCTCATTGCTGCCCAATTTCTCTGCATTTTTACCTCACGCGTCTGCTTCATTTTGATACTAAACCCGCGCCCACAACAACACGAGCAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTAATTCGACTTGAATGTGTGCTTTCAAGTTCTTATTCTTCCAACTCAGCAGACAAAAATGTTGTTAATGGCATAAATGGAGGTGTTGCCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCAGGGACATTGGAGGAATATCTCAAGAATAGCAAAGTTATTGGCGGTGAAGTAGAGGCACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAGCATTTCTGGTTTTCGCTTCGCAACACCAGCAGCCCCCTCAG
  5   1   2       bld Neu7 5g3  out                        XL032e20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGAAGCGGAGACTCCTCTCCTGCACAACTGACACATTGCGCACAGGCGCCTGAGTATCGGCCCCTCATTGCTGCCCAATTTCTCTGCATTTTTACCTCACGCGTCTGCTTCATTTTGATACTAAACCCGCGCCCACAACAACACGAGCAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTAATTCGACTTGAATGTGTGCTTTCAAGTTCTTATTCTTCCAACTCAGCAGACAAAAATGTTGTTAATGGCATAAATGGAGGTGTTGCCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCAGGGACATTGGAGGAATATCTCAAGAATAGCAAAGTTATTGGCGGTGAAGTAGAGGCACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAGCATTTCTGGTTTTCGCTTCACAACACCAGCAGCCCCCTCAGGTGGAGGAGTCCTTAATCCTAAAGCCAATTTCTGAAAGAATCCTTGAAGTACAGTTATTCAGAGAAAAAAATCGTGGAAGTCAAATGTTCAACCACCTTTCTGCCATCAGTGAAAGTGTACCAGCACTTGGTTGGATTG
  5   1   2       bld Neu7 5g3  out                        XL013h03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGACTCCTCTCCTGCACAACTGACACATTGCGCACAGGCGCCTGAGTATCGGCCCCTCATTGCTGCCCAATTTCTCTGCATTTTTACCTCACGCGTCTGCTTCATTTTGATACTAAACCCGCGCCCACAACAACACGAGCAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTAATTCGACTTGAATGTGTGCTTTCAAGTTCTTATTCTTCCAACTCAGCAGACAAAAATGTTGTTAATGGCATAAATGGAGGTGTTGCCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCAGGGACATTGGAGGAATATCTCAAGAATAGCAAAGTTATTGGCGGTGAAGTAGAGGCACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAGCATTTCTGGTTTTCGCTTCGCAACACCAGCAGCCCCCTCAGGTGGAGGAGTCCTTAATCCTAAAGCCAATTTCTGAAAGAATCCTTGAAGTACAGTTATTCAGAGAAAAAAATCGTGGAAGTCAAATGTT
  5   1   2      seed Tbd7 5g3  out                        XL054e18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGCCCCTCATTGCTGCCCAATTTATCTGCATTTTTACCTCACGCGTCTGCTTCATTTTGATACTAAACCCGCGCCCACAACAACACGAGCAGGCAGGTATTCAAAATGGCAGAAATGGATGGATTAATGGACAGGCTGGAGAAAGCTGTAATTCGACTTGAATGTGTGCTTTCAAGTTCTTATTCTTCCAACTCAGCAGACAAAAATGTTGTTAATGGCATAAATGGAGGTGTTGCCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCAGGGACATTGGAGGAATATCTCAAGAATAGCAAAGTTATTGGCGGTGAAGTAGAGGCACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAGCATTTCTGGTTTTCGCTTCGCAACACCAGCAGCCCCCTCAGGTGGAGGAGTCCTTAATCCTAAAGCCAATTTCTGAAAGAATCCTTGAAGTACAGTTATTCAGAGAAAAAAATCGTGGAAGTCAAATGTTCAACCACCTTTCTGCCATCAGTGAAAGTGTACCAGCACTTGGTTGGATTGCCATGTCGCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCAACACCATGTGGATTGGGTCAAATCTTACTTGAATATATGGAGCGAGCTGCAAGCGTACATT
  5   1   2       bld Tbd7      out                        XL105m03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATAAATGGAGGTGTTGCCCCATTTGTGGAAGCTTTTGATGCGCTGATGGCAGGGACATTGGAGGAATATCTCAAGAATAGCAAAGTTATTGGCGGTGAAGTAGAGGCACATGCTGGAATGGTGGAAAATGCCTTCAAAGCAGAAAGAGCATTTCTGGTTTTCGCTTCGCAACACCAGCAGCCCCCTCAGGTGGAGGAGTCCTTAATCCTAAAGCCAATTTCTGAAAGAATCCTTGAAGTACAGTTATTCAGAGAAAAAAATCGTGGAAGTCAAATGTTCAACCACCTTTCTGCCATCAGTGAAAGTGTACCAGCACTTGGTTGGATTGCCATGTCGCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCAACACCATGTGGATTGGGTCAAATCTTACTTGAATATATGGAGCGAGCTGCAAGCGTACATTAAGGAATATCACACCACAGGAGTTTCATGGGGAAATGCTATATATTCAATTCCACCAACTGCCAATGGAGGCACTCTACTGCAAAAATCATCTGAGC
  5   1   2       bld Tbd7      out                        XL092d01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAAATCGTGGAAGTCAAATGTTCAACCACCTTTCTGCCATCAGTGAAAGTGTACCAGCACTTGGTTGGATTGCCATGTCGCCAAAACCAGGTCCCTATGTCAAAGAGATGACTGATGCTGCTACCTTTTATACTAACAGGGTACTTAAAGATTACAAAAGCACTGACCAACACCATGTGGATTGGGTCAAATCTTACTTGAATATATGGAGCGAGCTGCAAGCGTACATTAAGGAATATCACACCACAGGAGTTTCATGGGGAAATGCTATATATTCAATTCCACCAACTGCCAATGGAGGCACTCTACTGCAAAAATCATCTGAGCCAAGTTTGTCCACCCCCTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)