Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5157121.5                       5 END     1          20       20                NCK interacting protein with SH3 domain [Xenopus (Silurana) tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012780183 Xl3.1-IMAGE:5155553.5 - 5 ESTs
                                                                       ......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5155553.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGGTCTGGCAGCAGGACCGTTTGTCAGGTCACGTGACCGCCGTGCTGATGGTAGCGATGCACCGCATTCAGACCCCAGAGCAGAGAGGGAAAACCGTCCAAAACAAAAGACGTAATCTAATCTGCATCGTTGTCTGAGACTTTGCTTTAGCCTGAGCCATGGAAAACCCAGAGTCAATGCAGACATGCAACTCTTTGGATGAACATGACAGTCCCTACTGCAAGCAGTGCCCGATGGCTGATGAGCTACTCAAGGAAGACAAGATACGAAGGGAACTTGAATTCTTTTTCATGAACCCCTGTGAGAAATTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCTGTGGTGACAGTCCAATTAGTTTTATTTGGACTCAGTAACGAAATGGTAGTCACTTTTAAAGAGGAGAACACTGTGGCTTTTAAGCATCTGTTTCTGAAAGGATACAAGGACATGCATGATGACACATATGCAATCTACAGTCAAGAAGATGTCCATACTCATATAAACTTTACAATTAAAAGGTACCTGGAGCTCCAAAATATATCTGTTGGAAACCATGCATATGAGAGTAATGGTGACGGTCAAACTGGGATGTCGTTATGCCAACATTTCTATAAACAAGGAACTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATTGAGACTGAATGTTTCTATATTGATCCATCAACTCTGTATTCTAATGACACACCTGCAGAAGCCTGGACTAATATGACACTAGACTTCTATAGGCTT
                                                  Xl3.1-CHK-1012705465                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGCAGCAGGACCGTTTGTCAGGTCACGTGACCGCCGTGCTGATGGTAGCGATGCACCGCATTCAGACCCCAGAGCAGAGAGGGAAAACCGTCCAAAACAAAAGACGTAATCTAATCTGCATCGTTGTCTGAGACTTTGCTTTAGCCTGAGCCATGGAAAACCCAGAGTCAATGCAGACATGCAACTCTTTGGATGAACATGACAGTCCCTACTGCAAGCAGTGCCCGATGGCTGATGAGCTACTCAAGGAAGACAAGATACGAAGGGAACTTGAATTCTTTTTCATGAACCCCTGTGAGAAATTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCTGTGGTGACAGTCCAATTAGTTTTATTTGGACTCAGTAACGAAATGGTAGTCACTTTTAAAGAGGAGAACACTGTGGCTTTTAAGCATCTGTTTCTGAAAGGATACAAGGACATGCATGATGACACATATGCAATCTACAGTCAAGAAGATGTCCATACTCATATAAACTTTACAATTAAAAGGTACCTGGAGCTCCAAAATATATCTGTTGGAAACCATGCATATGAGAGTAATGGTGACGGTCAAACTGGGATGTCGTTATGCCAACATTTCTATAAACAAGGAACTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATTGAGACTGAATGTTTCTATATTGATCCATCAACTCTGTATTCTAATGACACACCTGCAGAAGCCTGGACTAATATGACACTAGACTTCTATAGGCTTGTTTCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     159     501                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN     141      87                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR     159    1086                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG     159      38                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 3e-019     NP_001022722.1 Coelomocyte UPtake defective family member (cup-5) [Caenorhabditis elegans] ----------------=================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 6e-024     NP_649145.1 CG8743-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ag ---- 5e-025     XP_001687855.1 AGAP007710-PA [Anopheles gambiae str. PEST] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 4e-025     XP_001192652.1 PREDICTED: similar to mucolipin-3 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ==== 1e-047     XP_611818.4 PREDICTED: similar to Mucolipin-2 [Bos taurus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Dr ---- 4e-053     XP_693510.3 PREDICTED: similar to MGC80434 protein, partial [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Bt ==== 6e-072     XP_592179.3 PREDICTED: similar to mucolipin-3 [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 5e-072     XP_426647.2 PREDICTED: similar to Mucolipin 3 [Gallus gallus] ---============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 3e-072     XP_547306.2 PREDICTED: similar to mucolipin 3 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 1e-073     NP_598921.1 mucolipin 3; varitint-waddler; 6720490O21Rik [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 2e-075     NP_060768.8 mucolipin 3 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 4e-111     CAJ83717.1 mucolipin 3 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 2e-125     NP_001085683.1 MGC80434 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5155553.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAG---------------------------------------------ATG------ATG---------------------------------------------------------------------------TGA---------------TGA---ATG---------------ATG------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  5   1   2       bld Oo1  5x3  out                   IMAGE:3404694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACATATCCAAGGACCAATCGTAGCTCAGGCGGCTTTCGTGGGGGTCTTACCTTGTAGTTGCCGCTAGGTCTGGCAGCAGGACCGTTTGTCAGGTCACGTGACCGCCGTACTGATGGTAGCGATGCACCGCATTCAGACCCCAGAGCAGAGAGGGAAAACCGTCCAAAACAAAAGACGTAATCTAATCTGCATCGTTGTCTGAGACTTTGCTTTAGCCTGAGCCATGGAAAACCCAGAGTCAATGCAGACATGCAACTCTTTGGATGAACATGACAGTCCCTACTGCAAGCAGTGCCCGATGGCTGATGAGCTACTCAAGGAAGACAAGATACGAAGGGAACTTGAATTCTTTTTCATGAACCCCTGTGAGAAATTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCTGGGGTGACAGTCCAATTAGTTTTATTTGGACTCAGTAACGAAATGGTAGTCACTTTTAAAGAGGAGAACACTGTGGCTTTTAAG
  5   1   2       bld Emb1 5g                         IMAGE:5155553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGGTCTGGCAGCAGGACCGTTTGTCAGGTCACGTGACCGCCGTGCTGATGGTAGCGATGCACCGCATTCAGACCCCAGAGCAGAGAGGGAAAACCGTCCAAAACAAAAGACGTAATCTAATCTGCATCGTTGTCTGAGACTTTGCTTTAGCCTGAGCCATGGAAAACCCAGAGTCAATGCAGACATGCAACTCTTTGGATGAACATGACAGTCCCTACTGCAAGCAGTGCCCGATGGCTGATGAGCTACTCAAGGAAGACAAGATACGAAGGGAACTTGAATTCTTTTTCATGAACCCCTGTGAGAAATTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCTGTGGTGACAGTCCAATTAGTTTTATTTGGACTCAGTAACGAAATGGTAGTCACTTTTAAAGAGGAGAACACTGTGGCTTTTAAGCATCTGTTTCTGAAAGGATACAAGGACATGCATGATGACACATATGCAATCTACAGTCAAGAAGATGTCCATACTCATATAAACTTTACAATTAAAAGGTACCTGGAGCTCCAAAATATATCTGTTGGAAACCATGCATATGAGAGTAATGGTGACGGTCAAACTGGGATGTCGTTATGCCAACATTTCTATAAACAAGGAACTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATTGAGACTGAATGTTTCTATATTGATCCATCAACTCTGTATTCTAATGACACACCTGCAGAAGCCTGGACTAATATGACACTAGACTTCTATAGGCTTGTTTCAGTAAAAATATGTTTAAGCTGAAAGCGATCAATCTTCAAACCAT
  5   1   2       bld Ov1  5g                         IMAGE:8330448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCACGCGTCCGGTCACGTGACCGCCGTGCTGATGGTAGCGATGCACCGCATTCAGACCCCAGAGCAGAGAGGGAAAACCGTCCAAAACAAAAGACGTAATCTAATCTGCATCGTTGTCTGAGACTTTGCTTTAGCCTGAGCCATGGAAAACCCAGAGTCAATGCAGACATGCAACTCTTTGGATGAACATGACAGTCCCTACTGCAAGCAGTGCCCGATGGCTGATGAGCTACTCAAGGAAGACAAGATACGAAGGGAACTTGAATTCTTTTTCATGAACCCCTGTGAGAAATTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCTGTGGTGACAGTCCAATTAGTTTTATTTGGACTCAGTAACGAAATGGTAGTCACTTTTAAAGAGGAGAACACTGTGGCTTTTAAGCATCTGTTTCTGAAAGGATACAAGGACATGCATGATGACACATATGCAATCTACAGTCAAGAAGATGTCCATACTCATATAAACTTTACAATTAAAAGGTACCTGGAGCTCCAAAATATATCTGTTGGAAACCATGCATATGAGAGTAATGGTGACGGTCAAACTGGGATGTCGTTATGCCAACATTTCTATAAACAAGGTACTATCTTTTCTGGAAATGAAACATTGGAATTGACCCACAATTGAGACTGAATGTTCTATATTGATCCATCACTCTGTATTCTATTGAACC
  3  -1   2      seed Ov1  5g   out                   IMAGE:5048899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCGATCTAGAACTAGAAACCGTCCAAAACAAAAGACGTAATCTAATCTGCATCGTTGTCTGAGACTTTGCTTTAGCCTGAGCCATGGAAAACCCAGAGTCAATGCAGACATGCAACTCTTTGGATGAACATGACAGTCCCTACTGCAAGCAGTGCCCGATGGCTGATGAGCTACTCAAGGAAGACAAGATACGAAGGGAACTTGAATTCTTTTTCATGAACCCCTGTGAGAAATTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCTGTGGTGACAGTCCAATTAGTTTTATTTGGACTCAGTAACGAAATGGTAGTCACTTTTAAAGAGGAGAACACTGTGGCTTTTAAGCATCTGTTTCTGAAAGGATACAAGGACATGCATGATGACACATATGCAATCTACAGTCAAGAAGATGTCCATACTCATATAAACTTTACAATTAAAAGGTACCTGGAGCTCCAAAATATATCTGTTGGAAACCATGCATATGAGAGTAATGGTGACGGTCAAACTGGGATGTCGTTATGCCAACATTTCTATAAACAAGGAACTATCTTTCCTGGAAATGAAACATTTG
  5   1   2       bld Emb1 5g                         IMAGE:6635309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGCATCGTTGTCTGAGACTTTGCTTTAGCCTGAGCCATGGAAAACCCAGAGTCAATGCAGACATGCAACTCTTTGGATGAACATGACAGTCCCTACTGCAAGCAGTGCCCGATGGCTGATGAGCTACTCAAGGAAGACAAGATACGAAGGGAACTTGAATTCTTTTTCATGAACCCCTGTGAGAAATTCCGTGCCCGTGGACGAAAGCCTTGGAAGCTTTGTATTCAAATTTTAAAAATTGCTGTGGTGACAGTCCAATTAGTTTTATTTGGACTCAGTAACGAAATGGTAGTCACTTTTAAAGAGGAGAACACTGTGGCTTTTAAGCATCTGTTTCTGAAAGGATACAAGGACATGCATGATGACACATATGCAATCTACAGTCAAGAAGATGTCCATACTCATATAAACTTTACAATTAAAAGGTACCTGGAGCTCCAAAATATATCTGTTGGAAACCATGCATATGAGAGTAATGGTGACGGTCAAACTGGGATGTCGTTATGCCAACATTTCTATAAACAAGGAACTATCTTTCCTGGAAATGAAACATTTGAAATTGACCCACAAATTGAGACTGAATGTTTCTATATTGATCCATCAACTCTGTATTCTAATGACACACCTGCAGAAGCCTGGACTAATATGACACTAGACTTCTATAGGCTTGTTTCAGTAGAAATTATGTTTAAGCTGAAAGCGATCAATCTTCAAACCATTCGCCACCATGAACTTCCAGACTGCTATGACTTCATAATTACAATAACATTTGACAATAAAGCACACAGTGGAAGGATTAAAAATTACCCTTAACATAATGATGGTTGGGAATCCCAAGAATGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)