Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8549693.5                      23 END     1          16        4                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:5512710.5                       3 PI      91        112      720                MGC80767 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 85%

 1012780352 Xl3.1-IMAGE:7203928.5 - 6 ESTs
                                                                       ......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7203928.5                 GGGCGTGGATTTGGTTGCGGGCGAGCAGTCGCTGGTTTTGTCAGTAGATAACAGAAGCAGTGATAATTTGGCTGCGGTGAGTTACGCGGCTGCACTTCGGTATTGACACTCGCGGCGTTGCTTTGCCTGGCTGCTTTGGACTGATTTGTGACAAAAAGTAGTGGCTAAAATTTAAAATATTTTATTGGAGAGGATCTGTCCAACATGTCTGGAGTGAAGAAGCCTGTCCTGTTTCAGCCTTGGGAGGAAGATGAGTGCCTGGAATACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCACAGCTAACACAAAATGATATTGATGCCCTATCTTTCCTGCTGCATGAAACCCACCCCTTCACCCACCCTTTGGATCCCCAGCTATGGACAGCTGAAGAAGAGGCTGGTGAAGCAACGCCTAACCGTGCCTTGCTATCAGCTTGGCAAAGGTGGCATTGTGCTAGTAGGACACTTAATGAGAATAATTTGGATTCTCCAGATCTCCTGCGACCCAAGGATGGGACCGAGCTACTGCTTGAACTTGAGAGAAGAGGAAAATGTGACGAAAGCAATTTTACACATCTCTTGCAACTGTTGCGTGTATTAACACGTCATGACCTTCTCCCATATGTTTCCATGAAAAGACCCCGTGCAGTATCCCCTGAGCGGTATACGCATGGTCCGTCTATTTTGGATTCTGACAAGCAA
                                                  Xl3.1-CHK-1012700988                       GGATTTGGTTGCGGGCGAGCAGTCGCTGGTTTTGTCAGTAGATAACAGAAGCAGTGATAATTTGGCTGCGGTGAGTTACGCGGCTGCACTTCGGTATTGACACTCGCGGCGTTGCTTTGCCTGGCTGCTTTGGACTGATTTGTGACAAAAAGTAGTGGCTAAAATTTAAAATATTTTATTGGAGAGGATCTGTCCAACATGTCTGGAGTGAAGAAGCCTGTCCTGTTTCAGCCTTGGGAGGAAGATGAGTGCCTGGAATACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCACAGCTAACACAAAATGATATTGATGCCCTATCTTTCCTGCTGCATGAAACCCACCCCTTCACCCACCCTTTGGATCCCCAGCTATGGACAGCTGAAGAAGAGGCTGGTGAAGCAACGCCTAACCGTGCCTTGCTATCAGCTTGGCAAAGGTGGCATTGTGCTAGTAGGACACTTAATGAGAATAATTTGGATTCTCCAGATCTCCTGCGACCCAAGGATGGGACCGAGCTACTGCTTGAACTTGAGAGAAGAGGAAAATGTGACGAAAGCAATTTTACACATCTCTTGCAACTGTTGCGTGTATTAACACGTCATGACCTTCTCCCATATGTTTCCATGAAAAGACCCCGTGCAGTATCCCCTGAGCGGTATACGCATGGTCCGTCTATTTTGGATTCTGACAAGCAATGGGAT
                                                      consensus depths                      2     2     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     2     5     3     5
                                               BLH ATG     204     292                 
                                               BLH MIN     204      37                 
                                               BLH MPR     204      37                 
                                               BLH OVR     204      18                 
                                               CDS MIN     204      37                 
                                               EST CLI       0      14                 
                                               ORF LNG     204       1                 
                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 8e-020     XP_423146.1 PREDICTED: similar to death effector domain-containing protein; death effector domain-containing [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN --- Bt ---- 2e-028     NP_001069485.1 death effector domain-containing  DNA binding protein 2 [Bos taurus] =========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 1e-028     NP_997560.3 death effector domain-containing DNA binding protein 2 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 3e-029     NP_579874.1 death effector domain-containing  DNA binding protein 2 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                      PREDICTED - Cf ---- 2e-029     XP_855274.1 PREDICTED: similar to death effector domain-containing  DNA binding protein 2 [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 1e-034     NP_571677.1 death effector domain-conatining 1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PREDICTED = Xt ==== 3e-085     NP_001072481.1 hypothetical protein LOC779936 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                   PREDICTED = Xl ==== 8e-100     NP_001088715.1 hypothetical protein LOC495979 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7203928.5                                                                 TAA---------TGATAA---------------------------------------------------------------------------TGA---------------------TAA------------------------------------ATG------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld Te2N 5g                         IMAGE:7205430.5p TTTTTTTAACGGAGGGGGGCGTGGATTTGGTTGCGGGCGAGCAGTCGCTGGTTTTGTCAGTAGATAACAGAAGCAGTGATAATTTGGCTGCGGTGAGTTACGCGGCTGCACTTCGGTATTGACACTCGCGGCGTTGCTTTGCCTGGCTGCTTTGGACTGATTTGTGACAAAAAGTAGTGGCTAAAATTTAAAATATTTTATTGGAGAGGATCTGTCCAACATGTCTGGAGTGAAGAAGCCTGTCCTGTTTCAGCCTTGGGAGGAAGATGAGTGCCTGGAATACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCACAGCTAACACAAAATGATATTGATGCCCTATCTTTCCTGCTGCATGAAACCCACCCCTTCACCCACCCTTTGGATCCCCAGCTATGGACAGCTGAAGAAGAGGCTGGTGAAGCAACGCCTAACCGTGCCTTGCTATCAGCTTGGCAAAGGTGGCATTGTGCTAGTAGGACACTTAATGAGAATAATTTGGATTCTCCAGATCTCCTGCGACCCAAGGATGGGACCGAGCTACTGCTTGAACTTGAGAGAAGAGGAAAATGTGACGAAAGCAATTTTACACATCTCTTGCAACTGTTGCGTGTATTAACACGTCATGACCTTCTCCCATATGTTTCCATGAAAAGACCCCGTGCAGTATCCCCTGAGCGGTATACGCATGGTCCGTCTGTTTTGGATTCTGACAAGCAATGGGATGGATGTCTTAACCCCACCCCTACAAAAACCAGAGAGGAAAACTGGGAAAACAGGGTCTACCTCCCGGCaaaaaaaagccgaagggggaaactcaaaaaaagggggtccttggcccccaaatccaaaaaaaaaaaaaaaaTGGG
  5   1   2       bld Te2N 5g                         IMAGE:7203928.5p                 GGGCGTGGATTTGGTTGCGGGCGAGCAGTCGCTGGTTTTGTCAGTAGATAACAGAAGCAGTGATAATTTGGCTGCGGTGAGTTACGCGGCTGCACTTCGGTATTGACACTCGCGGCGTTGCTTTGCCTGGCTGCTTTGGACTGATTTGTGACAAAAAGTAGTGGCTAAAATTTAAAATATTTTATTGGAGAGGATCTGTCCAACATGTCTGGAGTGAAGAAGCCTGTCCTGTTTCAGCCTTGGGAGGAAGATGAGTGCCTGGAATACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCACAGCTAACACAAAATGATATTGATGCCCTATCTTTCCTGCTGCATGAAACCCACCCCTTCACCCACCCTTTGGATCCCCAGCTATGGACAGCTGAAGAAGAGGCTGGTGAAGCAACGCCTAACCGTGCCTTGCTATCAGCTTGGCAAAGGTGGCATTGTGCTAGTAGGACACTTAATGAGAATAATTTGGATTCTCCAGATCTCCTGCGACCCAAGGATGGGACCGAGCTACTGCTTGAACTTGAGAGAAGAGGAAAATGTGACGAAAGCAATTTTACACATCTCTTGCAACTGTTGCGTGTATTAACACGTCATGACCTTCTCCCATATGTTTCCATGAAAAGACCCCGTGCAGTATCCCCTGAGCGGTATACGCATGGTCCGTCTATTTTGGATTCTGANCAGCAATGGATGGATGTCTTAAACCAACCCTACAGAGACCAGAGAGGAAAACTGGGAACAGGGTCTACCTCAGCAAAGAAAGCGAGTGGAACTCAAAAGAGGGTCATTGCCAAATCAAAGAGAAATAAATGGGCAACACTCTTTGCAGATCGACTACCAAAGCAAAATAACATGGGGAAAACGT
  5   1   2       bld Te2N 5g                         IMAGE:7764690.5p                      TGGATTTGGTTGCGGGCGAGCAGTCGCTGGTTTTGTCAGTAGATAACAGAAGCAGTGATAATTTGGCTGCGGTGAGTTACGCGGCTGCACTTCGGTATTGACACTCGCGGCGTTGCTTTGCCTGGCTGCTTTGGACTGATTTGTGACAAAAAGTAGTGGCTAAAATTGAAAATATTTTATTGGAGAGGATCTGTCCAACATGTCTGGAGTGAAGAAGCCTGTCCTGTTTCAGCCTTGGGAGGAAGATGAGTGCCTGGAATACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCACAGCTAACACAAAATGATATTGATGCCCTATCTTTCCTGCTGCATGAAACCCACCCCTTCACCCACCCTTTGGATCCCCAGCTATGGACAGCTGAAGAAGAGGCTGGTGAAGCAACGCCTAACCGTGCCTTGCTATCAGCTTGGCAAAGGTGGCATTGTGCTAGTAGGACACTTAATGAGAATAATTTGGATTCTCCAGATCTCCTGCGACCCAAGGATGGGACCGAGCTACTGCTTGAACTTGAGAGAAGAGGAAAAATGTGACAAAAGCAATTTTACACATCTCTTGCAACTGTTGCCTGTATTAACACCTCATGACCTTCTCCCATATGTTTTCCTGAAAAGACCCCGTGCAAGAACCCCTGAAGCGGAAAACCCATGGTCCGTCTATTTTGGATTCTGAAAAGCAAATGGAAGGAATGTTTTAACCCTACCCC
  5   1   2       bld Te2  5g                         IMAGE:7392017.5p                        GATTTGGTTGCGGGCGAGCAGTCGCTGGTTTTGTCAGTAGATAACAGAAGCAGTGATAATTTGGCTGCGGTGAGTTACGCGGCTGCACTTCGGTATTGACACTCGCGGCGTTGCTTTGCCTGGCTGCTTTGGACTGATTTGTGACAAAAAGTAGTGGCTAAAATTTAAAATATTTTATTGGAGAGGATCTGTCCAACATGTCTGGAGTGAAGAAGCCTGTCCTGTTTCAGCCTTGGGAGGAAGATGAGTGCCTGGAATACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCACAGCTAACACAAAATGATATTGATGCCCTATCTTTCCTGCTGCATGAAACCCACCCCTTCACCCACCCTTTGGATCCCCAGCTATGGACAGCTGAAGAAGAGGCTGGTGAAGCAACGCCTAACCGTGCCTTGCTATCAGCTTGGCAAAGGTGGCATTGTGCTAGTAGGACACTTAATGAGAATAATTTGGATTCTCCAGATCTCCTGCGACCCAAGGATGGGACCGAGCTACTGCTTGAACTTGAGAGAAGAGGAAAATGTGACGAAAGCAATTTTACACATCTCTTGCAACTGTTGCGTGTATTAACACGTCATGACCTTCTCCCATATGTTTCCATGAAAAGACCCCGTGCAGTATCCCCTGAGCGGTATACGCATGGTCCGTCTNGTTTGGATTCTGACAAGCAAATGGATGGATGTCTTAACCCACCCCTACAGAGACCAGAGAGGAAACTGGNAAACAGGTCTACC
  5   1   2       bld Te2  5g                         IMAGE:7393814.5p                            TGGTTGCGGGCGAGCAGTCGCTGGTTTTGTCAGTAGATAACAGAAGCAGTGATAATTTGGCTGCGGTGAGTTACGCGGCTGCACTTCGGTATTGACACTCGCGGCGTTGCTTTGCCTGGCTGCTTTGGACTGATTTGTGACAAAAAGTAGTGGCTAAAATTTAAAATATTTTATTGGAGAGGATCTGTCCAACATGTCTGGAGTGAAGAAGCCTGTCCTGTTTCAGCTTTGGGAGGAAGATGAGTGCCTGGAATACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCACAGCTAACACAAAATGATATTGATGCCCTATCTTTCCTGCTGCATGAAACCCACCCCTTCACCCACCCTTTGGATCCCCAGCTATGGACAGCTGAAGAAGAGGCTGGTGAAGCAACGCCTAACCGTGCCTTGCTATCAGCTTGGCAAAGGTGGCATTGTGCTAGTAGGACACTTAATGAGAATAATTTGGATTCTCCAGATCTCCTGCGACCCAAGGATGGGACCGAGCTACTGCTTGAACTTGAGAGAAGAGGAAAATGTGACGAAAGCAATTTTACACATCTCTTGCAACTGTTGCGTGTATTAACACATCATGACCTTCTCCCATATGTTTCCATGAAAAGACCCCGTGCAGTATCCCCTGAGCGGTATACGCATGGTCCGTCTGTNNTTGATCTGANCAGCAATGGGATGATGTCTTNACCACCCCTACAGAGACAGAGAGGAAACTGGGAACAGGTCTACCTCAGCAAAGAA
  5   1   2      seed Ov1  5g3  out                   IMAGE:5072958.5p                                                            CCACGCGTCCGAAGCAGTGATAATTTGGCTGCGGTGAGTTACGCGGCTGCACTTCGGTATTGACACTCGCGGCGTTGCTTTGCCTGGCTGCTTTGGACTGATTTGTGACAAAAAGTAGTGGCTAAAATTGAAAATATTTTATTGGAGAGGATCTGTCCAACATGTCTGGAGTGAAGAAGCCTGTCCTGTTTCAGCCTTGGGAGGAAGATGAGTGCCTGGAATACTATGGCATGCTTTCCCTTCATCGCATGTTTGACATAGTTGGTTCACAGCTAACACAAAATGATATTGATGCCCTATCTTTCCTGCTGCATGAAACCCACCCCTTCACCCACCCTTTGGATCCCCAGCTATGGACAGCTGAAGAAGAGGCTGGTGAAGCAACGCCTAACCGTGCCTTGCTATCAGCTTGGCAAAGGTGGCATTGTGCTAGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)