Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8636385.5                     459 PI      90         47      366                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8637907.5                     286 PI      92         47      366                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:8638077.5                     143 PI      90          9      370                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8635896.5                     112 PI      91         44      391                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:8642082.5                      21 PI      90          4      543                (no blast hit)
     6   0.0    0Xl3.1-IMAGE:4684035-IMAGp.5                 7 PI      90         27      358                parvalbumin
     7   0.0    0Xl3.1-IMAGE:8636525.5                       6 PI      89         44      370                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:8642752.5                       2 PI      91         44      358                (no blast hit)

 This cluster: approximate FL confidence score = 87%

 1012780356 Xl3.1-IMAGE:4930137-IMAGp.5 - 10 ESTs
                                                                       ..-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4930137-IMAGp.5                                                               AGACTTGTATCCCTTTACTCCAGCTAAAGAGGACTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCTTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAATTAATTTTTTTTAAACCTGAACCTTCGAAACATCACAAGGTTTTTGCATTAAACTGATACAAGTAAACCTGGTTTAGTGGAACAAATATTTCTCTTCAATAATTCTTCTGTGATGTCATGTTGTGATGTCATGATTCATTTATTGGGTCCTTTTATTTATCCACCAGAGAAACATTGTTACCCTTGTCTACAGTTTATCTAAGAGTCCCTTAGTTAAACCAACATATTTATTCTCATTTTTATACTAATAATATTATTCATTGTTTTCACTGTTGAGACATTTGCAAATCCATGGATTTGCAAATCTTGCTCAAGTTTCCGTTGGACTGAAGCAAGCATAAAAAAAGTAATTGTTCTCAATAAATCAATTTT
                                                  Xl3.1-CHK-1012695988                                                                     GTATCCCTTTACTCCAGCTAAAGAGGACTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCTTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAATTAATTTTTTTTAAACCTGAACCTTCGAAACATCACAAGGTTTTTGCATTAAACTGATACAAGTAAACCTGGTTTAGTxxxxxxAATATTCCTCTTCAATAAxxxxxxTGTGATGxCAxGTTGTGAxGxCxxGATTCAxTxxTxGGGTCCTTTTATTTATCCACCAGAGAAACATTGTTACCCTTGTCTACAGTTTATCTAAGAGTCCCTTAGTTAAACCAACATATTTATTCTCATTTTTATACTAATAATATTATTCATTGTTTTCACTGTTGAGACATTTGCAAATCCATGGATTTGCAAATCTTGCTCAAGTTTCCGTTGGACTGAAGCAAGCATAAAAAAAGTAATTGTTCTCAATAAATCAxTTTTGGGATC
                                                      consensus depths                                                                    5     7     7     8     6     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     8     9     8     9     3     9     3     9     3     9     3     9     3     9     3     9     3     9     3     9     3     9     3     9     3     9     3     8     3     8     3     8     2     8     2     8     2     8     2     8     2     8     2     8     2     6     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     4     2     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAACCTGAATCTGTGAAAAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATACAAGTGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGACGCCTCTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGGGACAAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCCAGCGGCGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                               ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                           C-----------
                                               BLH ATG      46     275                                                               
                                               BLH MIN      16      32                                                               
                                               BLH OVR      46     155                                                               
                                               EST CLI      -5      84                                                               
                                               ORF LNG      46       1                                                               
                                                                       PROTEIN --- Dm ---- 4e-007     NP_725120.1 Calmodulin CG8472-PB [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 3e-007     NP_503386.1 Calmodulin CMD-1 (16.8 kD) (cmd-1) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 2e-007     XP_001177113.1 PREDICTED: similar to calmodulin 2 [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 2e-008     NP_001027633.1 calmodulin homologue [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================
                                                                          PROTEIN --- Os ---- 2e-008     NP_001066080.1 Os12g0132300 [Oryza sativa (japonica cultivar-group)] ==========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Bt ==== 2e-023     NP_001069582.1 parvalbumin [Bos taurus] ==========================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Cf ==== 5e-027     XP_546988.2 PREDICTED: similar to Oncomodulin (OM) (Parvalbumin beta) [Canis familiaris] ======================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Mm ==== 4e-027     XP_001480876.1 PREDICTED: similar to oncomodulin [Mus musculus] ==================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Hs ==== 2e-028     NP_006179.2 oncomodulin-like [Homo sapiens] ======================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Gg ==== 1e-038     NP_001007478.1 avian thymic hormone [Gallus gallus] =================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED = Dr ==== 1e-043     NP_956506.1 hypothetical protein MGC56217 [Danio rerio] =============================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Xl ==== 2e-055     NP_001079406.1 oncomodulin [Xenopus laevis] ============================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4930137-IMAGp.5                                                                                                             ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TAA------------------------------------------------------------ATG------------------------------------------------------------------------------------TAA------------TAA
                                                                   ORF                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Emb4 5g3  in                    IMAGE:4970573.5p                                    CGTCGACCCACGCGTCCGATCACAGGAAGACCCCTTTAAGTTTACTCCAGCTAAAGAGGACTTCGGACTGACCATGGCTTTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCTTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAATTAAttttttttAAAAAACCTGAATCTGTGAAAAATCCCAAACAAACTGATACAAGTGAAACCTGGTTTAGTGGACGCCTCTTCAATATTTCTCTTCATGGGACAAGATGTGATGTCATGATCCAGCGGCGGGATTCATTTATTTATCCACCAGAGAAGAATGGTTACCCTTGCCTACAGTTTATCTAAGAGCCCCTTAGTTAAACCAACATATTTACTTCTCATTTTTATACTAATAAAAACTGTCCAATGTTTACACTGTTGCGACTGTTCATTTTCCTATGGATTGAGGCACATAAGACCTATTTGCTCTCAATAAATCATTTTGGCAGACAATACCTACAACCGCGCAGATTGAATGTATTGGGCGGCTGCCCAAGATTTCCC
  3   1   2       bld Emb4 5g3  in                    IMAGE:4970573.3p                                                   CTGATCACAGGAAGACTTGTATCCCTTTACTCCAGCTAAAGAGGATTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCTTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAATTAATTTTTTTTAAAAAACCTGAATCTGTGAAAAATCCCAAACAAATTGATACAAGTGAAACTTGGTTTAGTGGACGCCTCTTCAATATTTCTCTTCATGGGACAAGATGTGATGTCATGATCCAGCGGCGGGATTCATTTATTTATCCACCAAGAGAAGAATGGTTACCCTTGCCTACAGTTTATCTAAGAGCCCCTTAGTTAAACCAACATATTTATTCTCATTTTTATACTAATAAAAACTGTCCTAATGTTTACACTGTTGCGACTGTT
  5   1   2       bld Tbd5 5g                IMAGE:3580267-IMAGp.IMAGp                                                        CCCGGGGCTTGTATCCCCTTTTACTCCCGCTAAAAAAGAACTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAAAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCTTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAACATTGGAGTTGAAGAATTCCAGGCTTTG
  5   1   2       bld Emb4 5x3               IMAGE:4930137-IMAGp.IMAGp                                                          CAGGAAGACTTGTATCCCTTTACTCCAGCTAAAGAGGACTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAAACCAAGGCCTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAACTAAATTTTTTTAAACCTGAACCTTCGAAACATCACAAGGTTTTTGCATTAAACTGATACAAGTAAACCTGGTTTAGTGGAACACAGACGCCTCTTCAATAATTCTTCTCTTGGGACAAGTTGTGATGTCATCATGTAGTAGTGGGGTCCTTTTATTTATCCACCAGAGAAACATTGTTACCCTTGTCTACAGTTTATCTAAGAGTCCCTTAGTTAAACCAACATATTTATTCTCATTTTTATACTAATAATATTATTCATTGTTTTCACTGTTGAGACATTTGCAAATCCATGGATTTGCAAATCTTGCTCAAGTTTCCGTTGGACTGAAGCAGGCATAAAAAAAGTAATTGTTCTCAATAAATCAATTTTGGAATCaaaaaaaaaa
  5   1   2       bld Emb4 5x3                        IMAGE:4930137.5p                                                           AGGAAGACTTGTATCCCTTTACTCCAGCTAAAGAGGACTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAAACCAAGGCCTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAACTAAATTTTTTTAAACCTGAACCTTCGAAACATCACAAGGTTTTTGCATTAAACTGATACAAGTAAACCTGGTTTAGTGGAACACAGACGCCTCTTCAATAATTCTTCTCTTGGGACAAGTTGTGATGTCATCATGTAGTAGTGGGGTCCTTTTATTTATCCACCAGAGAAACATTGTTACCCTTGTCTACAGTTTATCTAAGAGTCCCTTAGTTAAACCAACATATTTATTCTCATTTTTATACTAATAATATTATTCATTGTTTTCACTGTTGAGACATTTGCAAATCCATGGATTTGCAAATCTTGCTCAAGTTTCCGTTGGACTGAAGCAAGCATAAAAAAAGTATTGTTCTCAATAAATCAATTTTTGGGATCCaaaaaaaaaaaaaaG
  5   1   2       bld Emb4 5x3                        IMAGE:5537117.5p                                                           AGGAAGACTTGTATCCCTTTACTCCAGCTAAAGAGGACTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAAACCAAGGCCTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAACTAAATTTTTTTAAACCTGAACCTTCGAAACATCACAAGGTTTTTGCATTAAACTGATACAAGTAAACCTGGTTTAGTGGAACACAGAAGCCTCTTCAATAATTCTTCTCGTGGGACAAGTTGTGATGTCATCATCTAGTAGTGGGGTCCTTTTATTTATCCACCAGAGAAACATTGTTACCCCTTGCCTACAGTTTATCTAAGAGTCCCTTAGTTAAACCAACATATTTATTCTCATTTTTATACTAATAATATTATTCATTGTTTTCACTGTTGAGACATTTGCAAATCCATGGATTTGCAAATCTTGCTCAAGTTTCCGTTGGACTGAAGCAGGGATAAAAAAGTAATTGTTCTCCATAAATCAATTTTGGAAATCaaaaaaaaaaaaaaG
  5   1   2       add Emb4 5x                         IMAGE:5570850.5p                                                           AGGAAGACTTGTATCCCTTTACTCCAGCTAAAGAGAACTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCTTTTCCTGTCCAGCTTGGAGACTCTTGATGGTGGATGGGCAAAAATTGGGAGTTTGAAGAAAATTCCCAGGCTTTTGGGTGaaaaaaattaaattttttttttaaaaaaaaccctgaaatcctggggaaaaaaatcccccaaaacaaaaactggataacaaagtggaaaaaaccctgggggttttaaagggggaacccccccccccctccccaaaaaaatttccccccccccccccaggggggggaaaaaaaaaaaaaGGGGGGAAGATGGCCCCCTGGGAGAAACCCCCCCCCggggggggggggggggggtaaaatttttcttttttttt
  5   1   2      seed Tbd5 5g3  in                    IMAGE:3580267.5p                                                                   TTGTATCCCTTTACTCCAGCTAAAGAGAACTTCGGACTGACCATGGCATTCGGTGGTATCCTGAGTGAGGCTGACATCAACTCTGCTCTGCAGAACTGCCAAGCTGCTGACTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTGAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGCGGCTTCGTTGAGGAAGATGAACTGAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCTTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAATTAAttttttttAAAACCTGAATCTGTGAAAAATCCCAAACAAACTGATACAAGTGAAACCTGGTTTAGTGGACGCCTCTTCAATATTTCTCTTCATGGGACAAGATGTGATGTCATGATCCANCAGCGGGATTCATTTATTTATCCACCA
  3   1   2       add Tbd5 5g3  in                    IMAGE:3580267.3p                                                                                                                GCATTCGGTGGACTCCTGAGTGAGGCTGACATCAACTATGCTCTGCACACTTGCCAAGCTGCTGATTCCTTCAACTTCAAAACTTTCTTTGCCCAGTCTGGTCTGAGCAGCAAGTCCGCAGATGATGTCAGAAAAGTCTTTGCCATCATCGACCAGGACCAGAGGGGCTTTGTTGAGCAAGATGAACTGAAGCTGTTCCTCCAGACTTCCAAATCAGGTGCCAGAGCTTTACCTAATGCTGAGACCAAGGCTTTCCTGTCAGCTGTACACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAATTAATTTTTTTTAAAACCTGAATCTGTGAAAAATCCCAAACAAACTGATACAAGTGAAACCTGGTTTAGTGGACGCCTCTTCAATATTTCTCTTCATGGGACAAGATGTGATGTCATGATCCAGCGGCGGGATTCATTTATTTATCCACCAGAGAAGAATGGTTACCCTTGCCTACAGTTTATCTAAGAGCCCCTTAGTTAAACCAACATATTTATTCTCATTTTTATACTAATAAAAACTGTCCAATGTTTAAAAAA
  3   1   2       bld Emb4                            IMAGE:4202860.3p                                                                                                                                                                                                                                                                                        TTCGTTGAGGAAGATGAACTAAAGCTGTTCCTCCAGAACTTCAAATCAGGTGCCAGAGCTTTAACTGATGCTGAGACCAAGGCTTTCCTGTCAGCTGGAGACTCTGATGGTGATGGCAAAATTGGAGTTGAAGAATTCCAGGCTTTGGTGAAAAATTAATTTTTTTTAAAAAACCTGAATCTGTGAAAAATCCCAAACAAACTGATACAAGTGAAACCTGGTTTAGTGGACGCCTCTTCAATATTTCTCTTCATGGGACAAGATGTGATGTCATGATCCAGCGGCGGGATTCATTTATTTATCCACCAGAGAAGAATGGTTACCCTTGCCTACAGTTTATCTAAGAGCCCCTTAGTTAAACCAACATATTTATTCTCATTTTTATACTAATAAAAACTGTCCAATGTTTACACTGTTGCGACTGTTCATTTTCCTATGGATTGAGGCACAAAAAAACTAATTGTTCTCAATAAATCAATTTTGGAATCAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)