Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk142m01ex.3                         8 END     1           9       12                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012780400 Xl3.1-IMAGE:4030749.5 - 11 ESTs
                                                                       ..-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4030749.5                                                                                                                                                                                                                                                                                                                                             CAATGATTGTGGTCCGTTCATAAAGCTCAGTGATCCTGGAATCCCGATTACTGTGTTAACAAGACAAGAGCGGGTAGAGCGGATTCCATGGATTGCTCCTGAATGTGTTGAGGATTCCAGAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACATTATGGGAAATCTGTTTTAATGGAGAAGTGCCTCTCAAAGACCGGACCCTAGCCGAGAAAGAAAGATTTTATGGAGGGTGCTTCATGTTAGTGGCACCTTCATGCAAAGAGTTAGCAGATTTAATAAATCACTGCATGAATTATGACCCCAACAGAAGACCATTTTTTAGAGCAATCATGAGAGAAATTAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAATCACCATCTGCAGAAGTGGACCCAACTTTATTTGAGAAGAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCATTTTGGAAAAGTTGAACTATGTAGGTATGACCCAGAAGGCGACAACACTGGGGAACTGGTTGCTGTGAAATCGCTAAAGCCCGGCACAGGGGGCAGTCACATTGCTGATCTGAAAAAGGAAATTGAAATCCTGAGGAATCTGTATCATGAGAACATTGTGAAATACAAAGGAATTTGTGAAGATGGAGACAGTGGAATTAAACTTATAATGGAATATCTCCCATCAGGGAGTCTAAAGGAATACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGCTGAAATATGCAACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGGGATTTGGCAGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATCAAAATTGGAGATTTTGGTTTAACCAAGGCTATTCAAACCGATAAGGAATATTATACTGTCAAAGATGACCTGGACAGTCCTGTATTCTGGTACGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCAGAATACAGCCCAATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAGATGACTGTGACAAGACTTGTACGAGTGTTGGAAGAAGGAAAGCGCTTGCCAATCCCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGACCAAATGCTGGGAGCAAAATCCAAGTGACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCCATAATAAATGCTTTGTAGCCACACTGCTACACACGGGTGATAGGACGACCCTCATTCAGACCGTAGAACTGTCGTGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTGTTTGTGATATCTGTCTTCTACATTTGTACAACTAGATAAGAAATAAGAAACACCTTCTCTTGTGCGTTATAGCTTTGGGGCTTCGCTAATCAAAGCTGG
                                                  Xl3.1-CHK-1012694975                                                                                                                                                                                                                                                                                                                                                   TTGTGGTCCGTTCATAAAGCTCAGTGATCCTGGAATCCCGATTACTGTGTTAACAAGACAAGAGCGGGTAGAGCGGATTCCATGGATTGCTCCTGAATGTGTTGAGGATTCCAGAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACATTATGGGAAATCTGTTTTAATGGAGAAGTGCCTCTCAAAGACCGGACCCTAGCCGAGAAAGAAAGATTTTATGGAGGGTGCTTCATGTTAGTGGCACCTTCATGCAAAGAGTTAGCAGATTTAATAAATCACTGCATGAATTATGACCCCAACAGAAGACCATTTTTTAGAGCAATCATGAGAGAAATTAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAATCACCATCTGCAGAAGTGGACCCAACTTTATTTGAGAAGAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCATTTTGGAAAAGTTGAACTATGTAGGTATGACCCAGAAGGCGACAACACTGGGGAACTGGTTGCTGTGAAATCGCTAAAGCCCGGCACAGGGGGCAGTCACATTGCTGATCTGAAAAAGGAAATTGAAATCCTGAGGAATCTGTATCATGAGAACATTGTGAAATACAAAGGAATTTGTGAAGATGGAGACAGTGGAATTAAACTTATAATGGAATATCTCCCATCAGGGAGTCTAAAGGAATACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGCTGAAATATGCAACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGGGATTTGGCAGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATCAAAATTGGAGATTTTGGTTTAACCAAGGCTATTCAAACCGATAAGGAATATTATACTGTCAAAGATGACCTGGACAGTCCTGTATTCTGGTACGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCAGAATACAGCCCAATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAGATGACTGTTACAAGACTTGTACGAGTGTTGGAAGAAGGAAAGCGCTTGCCAATCCCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGACCAAATGCTGGGAGCAAAATCCAAGTGACCGGACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCCATAATAAATGCTTTGTAGCCACACTGCTACACACGGGTGATAGGACGACCCTCATTCAGACCGTAGAACTGTCGTGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTGTTTGTGATATCTGTCTTCTACATTTGTACAACTAGATAAGAAATAAGAAACACCTTCTCTTGTGCGTTATAGCTTTGGGGCTTCGCTAATCAAAGCTGGGGACAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                  2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     4     4     4     4     4     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     5     6     5     6     6     6     5     5     5     5     5     5     5     5     6     6     6     6     5     5     5     5     5     5     5     5     6     6     6     6     5     6     5     6     5     6     6     6     5     6     5     6     5     6     5     6     5     7     5     7     6     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     4     2     4     3     4     3     4     3     4     2     4     2     4     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---T--------
  5   1   2       bld Te2                             IMAGE:7210399.5p AAAAGTCATACTAAAAGTGCTGCATCCAAGTCATAGAGACTCTCTTTGGCATTTTTTGAGACTGCAAGTATGATGAGGCAGGTTTCACACAAGCACATTGTATTGCTTCACGGTGTATGTGTCAGAGATGTCGAAAATATAATGGTTGAGGAATTTGTGGACTTTGGCCCCCTTGATCTGTTCATGCATCGTAAAAGTGATGTTCTGACAACACCATGGAAATTCAAAGTTGCCAAGCAACTCGCTAGTGCCCTAAGCTACTTGGAAGATAAAGATTTAGTGCATGGAAACGTCTGCACTAAAAATATTTTACTGGCCAGAGAAGGAATTGACAATGATTGTGGTCCGTTCATAAAGCTCAGTGATCCTGGAATCCCGATTACTGTGTTAACAAGACAAGAGCGGGTAGAGCGGATTCCATGGATTGCTCCTGAATGTGTTGAGGATTCCAGAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACATTATGGGAAATCTGTTTTAATGGAGAAGTGCCTCTCAAAGACCGGACCCTAGCCGAGAAAGAAAGATTTTATGGAGGGTGCTTCATGTTAGTGGCGCCTTCATGCAAAGAGTTAGCAGATTTAATAAATCACTGCATGAATTATGACCCCAACAGAAGACCATTTTTTAGAGCAATCATGAGAGAAATTAACAAGCTGGAAGAGCATATCCAGACATTGTCTCTGAAAATCCCATCTGCAGA
  5   1   2       bld Gas9                                 BG410088.5p                                                                                                                                                                                                                                                                                                                                             CAATGATTGTGGTCCATTCATAAAGCTTAGTGATCCTGGAATACCAATTACTGTGTTAACAAGACAAGAGCGGGTAGAGCGCATTCCATGGATTGCTCCTGAATGTGTTGAGGATTCCAGAGTATTAAGTGTTGCTGCCGACAAATGGAGCTTTGGAACCACATTATGGGAAATCTGTTACAATGGAGAAGTGCCTCTCAAAGACCGAACCCTAGCAGAGAAAGAAAGATTCTACGGAGGATGCTTCATGTTAGTGGCACCTTCATGCAAAGAGTTAGCAGATCTAATAAATCATTGCATGAATTATGACCCCAACAGAAGACCGTTTTTTAGAGCAATCATGAGAGAAATCAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAAACACCATCTGCGGAAGTGGATCCAACTTTATTTGAGAAAATATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCATTTTGGAAAAGTTGAATTATGTAGGTATGACCCAGAAGGCGACAACACGGGGGAACTGGTTGCTGTTAAATCGCTAAAGCCTGGCACAGGGGGCAGTCGCATTGCTGATCTGAAAAANGAAATTGGAAATCCTGAGAAATCTGTATCATGAGAATATTGTGAAATACAAAGGAATTGTGAAGATGGAGACAGTGGAATTAAACTTATATGGAATATCTCC
  5   1   2       bld Egg3                            IMAGE:6324955.5p                                                                                                                                                                                                                                                                                                                                                                        CCCCGGGGCTGGAATCCCGATTACTGTGTTAACAAGACAAGAGCGGGTAGAGCGGATTCCATGGATTGCTCCTGAATGTGTTGAGGATTCCAGAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACATTATGGGAAATCTGTTTTAATGGAGAAGTGCCTCTCAAAGACCGGACCCTAGCCGAGAAAGAAAGATTTTATGGAGGGTGCTTCATGTTAGTGGCACCTTCATGCAAAGAGTTAGCAGATTTAATAAATCACTGCATGAATTATGACCCCAACAGAAGACCATTTTTTAGAGCAATCATGAGAGAAATTAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAATCACCATCTGCAGAAGTGGACCCAACTTTATTTGAGAAGAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCATTTTGGAAAAGTTGAACTATGTAGGTATGACCCAGAAGGCGACAACACTGGGGAACTGGTTGCTGTGAAATCGCTAAAGCCCGGCACAGGGGGCAGTCACATTGCTGATCTGAAAAAGGAAATTGAAATCCTGAGGAATCTGTATCATGAGAACATTGTGAAATACAAAGGAATTTGTGAAGATGGAGACAGTGGAATTAAACTTATAATGGAATATCTCCCATCAGGGAGTCTAAAGGAATACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGCTGAAATATGCAACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGGGATTTGGCAGCCAGGAATGTTCTTGTTNGAAATGGACAAATAATCAAAATGGGAGATTTTGGGTTTAACCAAGGCTATTCAAACCGATAAGGGATATTATACTGTCAAAGATGACCTGGACAGTCCTGAATTCTGGTACGCC
  5   1   2       bld Egg1                               PBX0025F01.5p                                                                                                                                                                                                                                                                                                                                                                                                             ACGAGGCGGGTAGAGCGGATTCCATGGATTGCTCCTGAATGTGTTGAGGATTCCAGAGTATTAAGTGTTGCTGCTGACAAGTGGAGCTTTGGAACCACATTATGGGAAATCTGTTTTAATGGAGAAGTGCCTCTCAAAGACCGGACCCTAGCCGAGAAAGAAAGATTTTATGGAGGGTGCTTCATGTTAGTGGCACCTTCATGCAAAGAGTTAGCAGATTTAATAAATCACTGCATGAATTATGACCCCAACAGAAGACCATTTTTTAGAGCAATCATGAGAGAAATTAACAAGCTGGAAGAGCAAAATCCAGACATTGTCTCTGAAAAATCACCATCTGCAGAAGTGGACCCAACTTTATTTGAGAAGAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCATTTTGGAAAAGTTGAACTATGTAGGTATGACCCAGAAGGCGACAACACTGGGGAACTGGTTGCTGTGAAATCGCTAAAGCCCGGCACAGGGGGCAGTCACATTGCTGATCTGAAAAAGGAAATTGAAATCCTGAGGAATCTGTATCATGAGAACATTGTGAAATACAAAGGAATTTGTGAAGATGGAGACAGTGGAATTAAACTTATAATGGAATATCTCCCATCAGGGAGTCTAAAGGAATACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGCTG
  5   1   2      seed Ga15      in                       XL429h01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAATCCAGACATTGTCTCTGAAAAATCACCATCTGCAGAAGTGGACCCAACTTTATTTGAGAAGAGATTCTTGAAGAGAGTAAGAGATCTAGGAGAGGGCCATTTTGGAAAAGTTGAACTATGTAGGTATGACCCAGAAGGCGACAACACTGGGGAACTGGTTGCTGTGAAATCGCTAAAGCCCGGCACAGGGGGCAGTCACATTGCTGATCTGAAAAAGGAAATTGAAATCCTGAGGAATCTGTATCATGAGAACATTGTGAAATACAAAGGAATTTGTGAAGATGGAGACAGTGGAATTAAACTTATAATGGAATATCTCCCATCAGGGAGTCTAAAGGAATACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGCTGAAATATGCAACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGGGATTTGGCAGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATCAAAATTGGAGATTTTGGTTTAACCAAGGCTATTCAAACCGATAAGGAATATTATACTGTCAAAGATGACCTGGACAGTCCTGTATTCTGGTACGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTCGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCANAATACAGCCCAATGACGATGTTTTTGAAAATGATTGGCCCA
  5   1   2       bld Kid                             IMAGE:4030749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGACGCGTGGGCGGACGCGTGGGATCTAGGAGAGGNGCCATTTTGGAAAAGTTGAACTATGTAGGTATGACCCAGAAGGCGACAACACTGGGGAACTGGTTGCTGTGAAATCGCTAAAGCCCGGCACAGGGGGCAGTCACATTGCTGATCTGAAAAAGGAAATTGAAATCCTGAGGAATCTGTATCATGAGAACATTGTGAAATACAAAGGAATTTGTGAAGATGGAGACAGTGGAATTAAACTTATAATGGAATATCTCCCATCAGGGAGTCTAAAGGAATACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGCTGAAATATGCAACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGGGATTTGGCAGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATCAAAATTGGAGATTTTGGTTTAACCAAGGCTATTCAAACCGATAAGGAATATTATACTGTCAAAGATGACCTGGACAGTCCTGTATTCTGGTACGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCAGAATACAGCCCAATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAGATGACTGTTACAAGACTTGTACGTGTGTTGGAAGAAAGAAAGCGCTTGCCAATCCCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGACCAAATGCTGGGAGCCAAATCCAAGTGGACCGCACCACTTTTCCGGGACCTAATTTAAAGGCTTTGAAGCCATTATAATTT
  3   1   2       bld Ga15      in                       XL429h01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAGATGGAGACAGTGGAATTAAAACTTATAATGGAATATCTCCCATCAGGGAGTNTAAAGGAATACCTTCCAAGAAATGTGAACAAAATCAATCTGAAACAGCAGCTGAAATATGCAACACAAATATGCAAGGGAATGGACTATTTGGGTTCACGTCAGTATGTCCATCGGGATTTGGCAGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATCAAAATTGGAGATTTTGGTTTAACCAAGGCTATTCAAACCGATAAGGAATATTATACTGTCAAAGATGACCTGGACAGTCCTGTATTCTGGTACGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTCGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCAGAATACAGCCCAATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAGATGACTGTTACAAGACTTGTACGTGTGTTGGAAGAAGGAAAGCGCTTGCCAATCCCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGACCAAATGCTGGGAGCAAAATCCAAGTGACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCGATTATAATTACTTTGTAGTCATATTCTACACACTGGTGAAAGGACGATCCTCACTCAGACTTTAGAACTGTCTTGATGCTGCTCCTGTGGATGCAGATTTTTGTTTTTCACTCTTCTGTTTGTGATATA
  5   1   2       bld Panc                            IMAGE:8737722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAAAATCAATCTGAAACAGCAGCTGAAATATGCAACACAAATATGCAAGGGCATGGACTATTTGGGCTCACGTCAGTATGTCCATCGAGATTTGGCTGCAAGGAATGTCCTTGTTGAAAACGAACAAATAATCAAAATTGGAGATTTTGGTTTGACCAAAACTATTGAAACCGATAAGGAATATTATACTGTCAAAGATGACCAGGATAGTCCTGTTTTCTGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTGTGGTCATTTGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAGATGACTGTGACAAGACTTGTACGAGTGTTGGAAGAAGGAAAGCGCTTGCCAATCCCAGCAAATTGCCCAAAGCAGTGTACCAGCTCATGACTAAATGTTGGGAACAGAATCCAAGTGACCGGACCACTTTTCAGACCTAATTAAAGGCTTTGAAGCCATAATAAATGCTTTGTAGCCACACTGCTACACACGGGTGATAGGACGACCCTCATTCAGACCGTAGAACTGTCGTGATGCTGCTCCTGTGATGCATAtttttgttttttATTCCGCACTTCTGTTTGTGGAAATCTGTTCTTCTACATTTGTACACTAGATAAGAAATAAGAACACCCTTCTCTCTTGTGCAATTATAGCTTTGGGGCTCGCTATCAAGCTGGGACGGGACTATAAGATCTGTCTGCGAATGATTTACATGATCCCACCAGTAGCTCTGAGCACATGTTGCTCCTCAACCCCTGGAAGATGGTCTGT
  5   1   2       bld Bone                            IMAGE:8743780.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCAGTATGTCCATCGGGATTTGGCAGCAAGGAATGTTCTTGTTGAAAATGAACAAATAATCAAAATTGGAGATTTTGGTTTAACCAAGGCTATTCAAACCGATAAGGGATATTATACTGTCAAAGATGACCTGGACAGTCCTGTATTCTGGTACGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTCTGGTCATTTGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCAGAATACAGCCCAATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAGATGACTGTTACAAGACTTGTACGTGTGTTGGAAGAAGGAAAGCGCTTGCCAATCCCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGACCAAATGCTGGGAGCAAAATCCAAGTGACCGCACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCGATTATAATTACTTTGTAGTCATATTCTACACACTGGTGAAAGGACGATCCTCACTCAGACTTTAGAACTGTCTTGATGCTGCTCCTGTGGATGCAGATTTTTGTTTTTCACTCTTCTGTTTGTGATATATGTCTTCTACCTTTCTACAACTAGATAGGAAATAAGAAAAGCTTCCCTTGTGAATTATACCTCTGGGGCTTGACCAAGCAAAGCTGGGAGCAGTTAAATGGGATGTTCACTTTAAAGTTAACTGTTAGTATTCAttttttttttacttgtggtttttgagttatttagcttttatttagcagctctccagtttgtaattttAGCATCTGTGCTAGAGCCAATTACATAGCACATGCATGGATTTGATAGAGACTGCATATGATAGAAGGAACTAATAAAGAGGAGTATAAAGTAACCATTAC
  5   1   2       add Panc                            IMAGE:8737109.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGACATAAATAGAAGATCACATCGTATTCGAATTCGTCCCCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTGTGGTCATTTGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAGATGACTGTGACAAGACTTGTACGAGTGTTGGAAGAAGGAAAGCGCTTGCCAATCCCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGACTAAATGTTGGGAACAGAATCCAAGTGACCGGACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCCATAATAAATGCTTTGTAGCCACACTGCTACACACGGGTGATAGGACGACCCTCATTCAGACCGTAGAACTGTCGTGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTGTTTGTGATATCTGTCTTCTACATTTGTACAACTAGATAAGAAATAAGAAACACCTTCTCTTGTGCGTTATAGCTTTGGGGCTTCGCTAATCAAAGCTGGGGACAGGGGACTTAAGGAAGATACTGGCTCCTGCAGAAATTTGATGTAACAGAACTGTAAGACTCCCCAGACTTGCGCAGACACATACAGAGAGGCTTTATATGTGAAACTCCCCTAAAATTCTCTCCTAATACATGCTCTATTCATAACTTCAGTTCTACCAAATAAATAGAAATGTATATACATGTATAATATAAATCATGGGATCATTCTTGCTCATTGCAGAACACAAATATTAACACTTTCAGATAAATATATAAAATAAAAAGTGCAGCATGCTACATGTGATTTTTAGATGCTTGCTTATAGCTGGACTTATTGCGTCTAGCCTGGTTCTGCATTCGGCAATTAGTATATAATATTGCA
  5   1   2       add Tbd7      out                        XL095f08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTGTTTTCTGGTATGCTCCAGAATGTTTGCTGCACTGCAAGTTTTACATTGCCTCTGATGTGTGGTCATTTGGAGTAACCTTGTACGAACTGCTGACATACTGCAATTCAGAATACAGTCCTATGACGATGTTTTTGAAAATGATTGGCCCAACACAAGGACAGATGACTGTGACAAGACTTGTACGAGTGTTGGAAGAAGGAAAGCGCTTGCCAATCCCAGCAAACTGCCCAAAGCAGGTGTACCAGCTCATGACTAAATGTTGGGAACAGAATCCAAGTGACCGGACCACTTTTCAGGACCTAATTAAAGGCTTTGAAGCCATAATAAATGCTTTGTAGCCACACTGCTACACACGGGTGATAGGACGACCCTCATTCAGACCGTAGAACTGTCGTGATGCTGCTCCTGTGGATGCATATTTTTGTTTTTATTCGCACTTCTGTTTGTGATATCTGTCTTCTACATTTGTACAACTAGATAAGAAATAAGAAACACCTTCTCTTGTGCATTATAGCTTTGGGGCTTCGCTAATCAAAGCTGGGGACAGGGGAAGATACTGGCTCCTGCAGAAATTTGATGTAACAGAACTGTAAGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)