Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 8%

 1012780545 Xl3.1-IMAGE:6316350.5 - 6 ESTs
                                                                       ...-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6316350.5                                                                                                                                                                                                                                                                                                                                                                            CTGTCACTTTGCAACAGCAGCAACTCCCCGTCACCCGCACAGTCAGAGCAACACGCGAACGGCACGAGCCCCACTGGCACCCCAGCAGCAGCCGCCTATCATCAGCCTATCAGCATGGAGACCTCCGCTGCCAACCTGTCCAGCCAACAGCATTTCCTGCAGCCTCCTTGTTTCTTCCCGCACAACGTGCGGCTGAGCCCGGCGGAGGAGCAAGAAGCGGTCAAGCCGAAGCCCATCAAGAGGCAGCGCTCGAGTTCCCCGGAGCTGATGAGGTGCAAGAGGCGACTGAACTTCAATGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGAGTGAAGCTGGTCAATCTCGGCTTTGCCACCCTGAGAGAGCACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAGACGCTGCGATCGGCCGTCGAGTACATCAGGGCGCTGCAACAGCTGCTGGACGAACATGACGCGGTCAGCGCCGCTTTCCAGTCCGGCGTCTTTTCCCCCAACATCTCCCCTAACTATTCTCATGGTATGAACTCTATGGCGGGGTCTCCCGTCTCCTCGTACTCCTCAGATGAAGGCTCCTATGATCCGCTCAGCCCTGAGGAGCAAGAGCTGCTCGACTTCACCACTTGGTTCTGAGACACTGAGAAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCGCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGACGGATAGAGACATAATGCAGTGGGGGTCGTGGGTGGTGCAGCACACATACACCATCCCAGCTCACACGCGGAAGAGAC
                                                  Xl3.1-CHK-1012703118                                                                                                                                                                                                                                                                                                                                                                                  CTTTGCAACAGCAGCAACTCCCCGTCACCCGCACAGTCAGAGCAACACGCGAACGGCACGAGCCCCACTGGCACCCCAGCAGCAGCCGCCTATCATCAGCCTATCAGCATGGAGACCTCCGCTGCCAACCTGTCCAGCCAACAGCATTTCCTGCAGCCTCCTTGTTTCTTCCCGCACAACGTGCGGCTGAGCCCGGCGGAGGAGCAAGAAGCGGTCAAGCCGAAGCCCATCAAGAGGCAGCGCTCGAGTTCCCCGGAGCTGATGAGGTGCAAGAGGCGACTGAACTTCAATGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGAGTGAAGCTGGTCAATCTCGGCTTTGCCACCCTGAGAGAGCACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAGACGCTGCGATCGGCCGTCGAGTACATCAGGGCGCTGCAACAGCTGCTGGACGAACATGACGCGGTCAGCGCCGCTTTCCAGTCCGGCGTCTTTTCCCCCAACATCTCCCCTAACTATTCTCATGGTATGAACTCTATGGCGGGGTCTCCCGTCTCCTCGTACTCCTCAGATGAAGGCTCCTATGATCCGCTCAGCCCTGAGGAGCAAGAGCTGCTCGACTTCACCACTTGGTTCTGAGACACTGAGAAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCGCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGACGGATAGAGACATAATGCAGTGGGGGTCGTGGGTGGTGCAGCACACATACACCATCCCAGCTCACACGCGGAAGAGACGTGGTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                 2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG     114      10                                                                                                                                                                                                                                                                                                                                                                            
                                               BLH MIN      30      75                                                                                                                                                                                                                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 2e-012     NP_495938.3 Helix Loop Helix family member (hlh-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - ?? ---- 6e-013     XP_001254352.2 PREDICTED: similar to ASCL3 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 2e-016     NP_001071656.1 transcription factor protein [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 8e-018     NP_476623.1 CG3839-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ag ---- 1e-018     XP_316851.3 AGAP000876-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 5e-040     XP_001185512.1 PREDICTED: similar to Achaete-scute complex-like 1 (Drosophila) [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Gg ---= 2e-079     NP_989743.1 achaete-scute complex-like 1 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 2e-079     NP_004307.2 achaete-scute complex homolog-like 1 [Homo sapiens] -------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 2e-079     NP_032579.2 achaete-scute complex homolog-like 1; mammalian achaete scute homolog 1 [Musmusculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 9e-080     XP_539745.2 PREDICTED: similar to Achaete-scute homolog 1 [Canis familiaris] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dr ---- 2e-080     NP_571294.1 achaete-scute complex-like 1a [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Bt ---= 2e-081     XP_594382.3 PREDICTED: similar to Achaete-scute complex homolog 1 (Drosophila) [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 2e-107     NP_001085994.1 MGC83023 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6316350.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------TGA---------------------------------------------TGA------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2       bld Emb4 5x3                        IMAGE:5570622.5p                                                                                                                                                                                                                                                                                                                                                                GCGGGGCCGCTCCTGTCACTTTGCAACAGCAGCAACTCCCCGTCACCCGCACAGTCAGAGCAACACGCGAACGGCACGAGCCCCACTGGCACCCCAGCAGCAGCCGCCTATCATCAGCCTATCAGCATGGAGACCTCCGCTGCCAACCTGTCCAGCCAACAGCATTTCCTGCAGCCTCCTTGTTTCTTCCCGCACAACGTGCGGCTGAGCCCGGCGGAGGAGCAAGAAGCGGTCAAGCCGAAGCCCATCAAGAGGCAGCGCTCGAGTTCCCCGGAGCTGATGAGGTGCAAGAGGCGACTGAACTTCAATGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGAGTGAAGCTGGTCAATCTCGGCTTTGCCACCCTGAGAGAGCACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAGACGCTGCGATCGGCCGTCGAGTACATCAGGGCGCTGCAACAGCTGCTGGACGAACATGACGCGGTCAGCGCCGCTTTCCAGTCCGGCGTCTTTTCCCCCAACATCTCCCCTAACTATTCTCATGGTATGAACTCTATGGCGGGGTCTCCCGTCTCCTCGTACTCCTCAGATGAAGGCTCCTATGATCCGCTCAGCCCTGAGGAGCAAGAGCTGCTCGACTTCACCACTTGGTTCTGAGACACTGAGAAAGCAGGCTGTTTGCCTCCCTGCTTGGATAANCAAGTGAAGCGCACANGGAGCAGTCGGGTCCCTCCCAGAACACTGAAAGCACTACATTTGGCACTCCAGTAGGATTCACTGGGACGGATAGAGNA
  5   1   2       bld Te2N 5g                         IMAGE:7206587.5p                                                                                                                                                                                                                                                                                                                                                                            CTGTCACTTTGCAACAGCAGCAACTCCCCGTCACCCGCACAGTCAGAGCAACACGCGAACGGCACGAGCCCCACTGGCACCCCAGCAGCAGCCGCCTATCATCAGCCTATCAGCATGGAGACCTCCGCTGCCAACCTGTCCAGCCAACAGCATTTCCTGCAGCCTCCTTGTTTCTTCCCGCACAACGTGCGGCTGAGCCCGGCGGAGGAGCAAGAAGCGGTCAAGCCGAAGCCCATCAAGAGGCAGCGCTCGAGTTCCCCGGAGCTGATGAGGTGCAAGAGGCGACTGAACTTCAATGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGAGTGAAGCTGGTCAATCTCGGCTTTGCCACCCTGAGAGAGCACGTCCCCAACGGTGCGGCCAACTAGAAGATGAGCAAAGTGGAGACACTGCGATCTGCCGTCAAGTACATCAGGGCGCTGCAACAGCTGCTGGACCAAAATGACGCGATCAGCGACGCTTTCCAGTCCGGCGTCCTTTCCCCCACATCTTCCCTAACTATTCTCCTGGTTATAACTCAATggggggggTTCCCGTTCCCATCGTATTCTTGGATGAAAGCTTCTAAGATCCCCCTCCGCATGAGGAAGAAAATCTTCTCAAATTTTCCCATCGGTTTTCGAACACATTAGAAACCAGG
  5   1   2       bld Ov1                             IMAGE:6316350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACGCGTGGGCGGACGCGTGGGCGCACAACGTGCGGCTGAGCCCGGCGGAGGAGCAAGAAGCGGTCAAGCCGAAGCCCATCAAGAGGCAGCGCTCGAGTTCCCCGGAGCTGATGAGGTGCAAGAGGCGACTGAACTTCAATGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGAGTGAAGCTGGTCAATCTCGGCTTTGCCACCCTGAGAGAGCACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAGACGCTGCGATCGGCCGTCGAGTACATCAGGGCGCTGCAACAGCTGCTGGACGAACATGACGCGGTCAGCGCCGCTTTCCAGTCCGGCGTCTTTTCCCCCAACATCTCCCCTAACTATTCTCATGGTATGAACTCTATGGCGGGGTCTCCCGTCTCCTCGTACTCCTCAGATGAAGGCTCCTATGATCCGCTCAGCCCTGAGGAGCAAGAGCTGCTCGACTTCACCACTTGGTTCTGAGACACTGAGAAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCGCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGACGGATAGAGACATAATGCAGTGGGGGGTCGTGGGGTGGTGCAGCACACATACACCATCCCAGCTCACACGCGGAAAGAGACGTGGTCCATATGAACAACCCGGGGGCTACCCCCGAATAAAACGCAAGCCCCTTAATTGACTGGTATGGCTCCttttttttATCCTAAGGGAGAACGGGTTTCCCCTGGATCAC
  3   1   2      seed Te2N      in                    IMAGE:7203640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGGTCAAGCCGAAGCCCATCAAGAGGCAGCGCTCGAGTTCCCCGGAGCTGATGAGGTGCAAGAGGCGACTGAACTTCAATGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGAGTGAAGCTGGTCAATCTCGGCTTTGCCACCCTGAGAGAGCACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAGACGCTGCGATCGGCCGTCGAGTACATCAGGGCGCTGCAACAGCTGCTGGACGAACATGACGCGGTCAGCGCCGCTTTCCAGTCCGGCGTCTTTTCCCCCAACATCTCCCCTAACTATTCTCATGGTATGAACTCTATGGCGGGGTCTCCCGTCTCCTCGTACTCCTCAGATGAAGGCTCCTATGATCCGCTCAGCCCTGAGGAGCAAGAGCTGCTCGACTTCACCACTTGGTTCTGAGACACTGAGAAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCGCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGACGGATAGAGACATAATGCAGTGGGGGTCGTGGGTGGTGCAGCACACATACACCATCCCAGCTCACACGCGGAAGAGACGTGGTCCATAGAACAACCCGGGTACCCATAACGCGCCGGC
  5   1   2       bld Te2N      in                    IMAGE:7203640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGTCAAGCCGAAGCCCATCAAGAGGCAGCGCTCGAGTTCCCCGGAGCTGATGAGGTGCAAGAGGCGACTGAACTTCAATGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGAGTGAAGCTGGTCAATCTCGGCTTTGCCACCCTGAGAGAGCACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAGACGCTGCGATCGGCCGTCGAGTACATCAGGGCGCTGCAACAGCTGCTGGACGAACATGACGCGGTCAGCGCCGCTTTCCAGTCCGGCGTCTTTTCCCCCAACATCTCCCCTAACTATTCTCATGGTATGAACTCTATGGCGGGGTCTCCCGTCTCCTCGTACTCCTCAGATGAAGGCTCCTATGATCCGCTCAGCCCTGAGGAGCAAGAGCTGCTCGACTTCACCACTTGGTTCTGAGACACTGAGAAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCGCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGACGGATAGAGACATAATGCAGTGGGGGTCGTGGGTGGTGCAGCACACATACACCATCCCAGCTCACACGCGGAAGAGACGTGGTCCATATGAACAACCCGGGGCTACCCCGAATAAAACGCAAGCCCTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGG
  5   1   2       bld Egg1                               PBX0057A07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGCGACTGAACTTCAATGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGAGTGAAGCTGGTCAATCTCGGCTTTGCCACCCTGAGAGAGCACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAGACGCTGCGATCGGCCGTCGAGTACATCAGGGCGCTGCAACAGCTGCTGGACGAACATGACGCGGTCAGCGCCGCTTTCCAGTCCGGCGTCTTTTCCCCCAACATCTCCCCTAACTATTCTCATGGTATGAACTCTATGGCGGGGTCTCCCGTCTCCTCGTACTCCTCAGATGAAGGCTCCTATGATCCGCTCAGCCCTGAGGAGCAAGAGCTGCTCGACTTCACCACTTGGTTCTGAGACACTGAGAAGCAGGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)