Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL056p21.3                            3 END     3          42      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:5078696.5.5                    45 PI      78        310      579                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7980842.5                      20 PI      78        310      579                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012780600 Xl3.1-IMAGE:8077725.5 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8077725.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAATCCCCCTTTCCTCTCTCACCCCTCGTTTTCTTTTCTTATCACTCGTACAAACCACAGACTTCCTCATTTTACTTTTTCAGAAAGAAATAGAAAAGAGCAAGAGCTTTGTTATATTATTTTGGATCTTTATGATATGCTTTTCATTAAACTAACCAGTAACCTGACTGCTTGAAATAAACTTCCAGTCTGTCTCCAGCACTTCCCAGCAGACTTTGGCTGACATTCACACAAGCTTCTTACCAAGAGACCACAATGAACAGCAACATAGCAGAAAAGGAGTGCTCCCCAGATGAGATCAACCTTCCAGAAGAAGAGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATCAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCCAGTAGGTTTCGTTAGTTTTGACAGTCGATCAGAAGCTGAAGCAGCCAAGAATGCATTAAATGGAATCAGATTTGATCCAGAAATTCCTCAGACGTTACGCCTGGAGTTTGCAAAGGCAAACACAAAGATGGCCAAGAGCAAGCTTGTTGGCACCCCAAATCCCAGCGCACCTCAGCTGAACAGCTTACCTCAATTTATTTCTAGGGATCAGTATGAGCTCACAGTGCCTGCACTTTATCCGGGTAGCCCAGAAGTGTGGGCGCCATACCCCCTCTACACAGCGGAGTTAGCACC
                                                  Xl3.1-CHK-1012699854                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCTTTCCTCTCTCACCCCTCGTTTTCTTTTCTTATCACTCGTACAAACCACAGACTTCCTCATTTTACTTTTTCAGAAAGAAATAGAAAAGAGCAAGAGCTTTGTTATATTATTTTGGATCTTTATGATATGCTTTTCATTAAACTAACCAGTAACCTGACTGCTTGAAATAAACTTCCAGTCTGTCTCCAGCACTTCCCAGCAGACTTTGGCTGACATTCACACAAGCTTCTTACCAAGAGACCACAATGAACAGCAACATAGCAGAAAAGGAGTGCTCCCCAGATGAGATCAACCTTCCAGAAGAAGAGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATCAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCCAGTAGGTTTCGTTAGTTTTGACAGTCGATCAGAAGCTGAAGCAGCCAAGAATGCATTAAATGGAATCAGATTTGATCCAGAAATTCCTCAGACGTTACGCCTGGAGTTTGCAAAGGCAAACACAAAGATGGCCAAGAGCAAGCTTGTTGGCACCCCAAATCCCAGCGCACCTCAGCTGAACAGCTTACCTCAATTTATTTCTAGGGATCAGTATGAGCTCACAGTGCCTGCACTTTATCCGGGTAGCCCAGAAGTGTGGGCGCCATACCCCCTCTACACAGCGGAGTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     4     3     4     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4
                                               BLH ATG     256     184                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     256      79                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     256     963                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -12       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     256      22                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 3e-026     XP_001190727.1 PREDICTED: similar to Cpo 61.1 protein - fruit fly (Drosophila melanogaster) [Strongylocentrotus purpuratus] ============================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 3e-028     NP_492508.1 MEChanosensory abnormality MEC-8, regulator of alternative splicing, RNA-BindingProtein with Multiple Splicing homolog, also involved in mechanosensation (33.5kD) (mec-8) [Caenorhabditis elegans] ===========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ag ==== 5e-032     XP_551112.3 AGAP001692-PA [Anopheles gambiae str. PEST] ======================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-035     NP_524844.5 couch potato CG31243-PF, isoform F [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = ?? ==== 1e-057     XP_596374.4 PREDICTED: similar to RNA binding protein with multiple splicing 2 [Bos taurus] =====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dr ---- 2e-059     NP_001002409.1 zgc:92689 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Xt ---- 2e-059     NP_001107477.1 hypothetical protein LOC100135328 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Cf ---- 2e-068     XP_532815.2 PREDICTED: similar to RNA-binding protein with multiple splicing (RBP-MS) [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 2e-069     XP_426296.2 PREDICTED: similar to RBP-MS/type 1 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---= 2e-074     NP_001036139.1 RNA binding protein gene with multiple splicing isoform 2 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 9e-075     NP_001008712.1 RNA-binding protein with multiple splicing isoform C [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Bt ==== 4e-075     NP_001040000.1 RNA-binding protein with multiple splicing [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Xl ==== 1e-086     NP_001083477.1 hypothetical protein LOC398948 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8077725.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAG---------------------------------------TGA------------TAA---------TAA---------------TAA---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ...
  5   1   2       bld Ga12 5g3  out                        XL186c16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTAAAGCCTTCCCCTTCAGAAAGCAAAGGCTGCTCCTAACCCTAATCACCAACAGTCACTCGCAATCCCCCTTTCCTCTCTCACCCCTCGTTTTCTTTTCTTATCACTCGTACAAACCACANACTTCCTCNTTTTACTTTTTCAGAAAGAAATAGAAAAGAGCAAGAGCTTTGTTATATTATTTTGGATCTTTATGATATGCTTTTCATTAAACTAACCAGTAACCTGACTGCTTGAAATAAACTTCCAGTCTGTCTCCAGCACTTCCCAGCAGACTTTGGCTGACATTCACACAAGCTTCTTACCAAGAGACCACAATGAACAGCNACATAGCAGAAAAGGAGTGCTCCCCAGATGAGATCAACCTTCCAGAAGAAGAGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATCAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCC
  5   1   2       bld Kid  5g                         IMAGE:4030673.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTACAGTCACTCACAATCCCCCTTTCCTCTCTCACCCCTCGTTTTCTTTTCTTATCACTCGTACAAACCACAGACTTCCTCATTTTACTTTTTCAGAAAGAAATAGAAAAGAGCAAGAGCTTTGTTATATTATTTTGGATCTTTATGATATGCTTTTCATTAAACTAACCAGTAACCTGACTGCTTGAAATAAACTTCCAGTCTGTCTCCAGCACTTCCCAGCAGACTTTGGCTGACATTCACACAAGCTTCTTACCAAGAGACCACAATGAACAGCAACATAGCAGAAAAGGAGTGCCCCCCAGATGAGATCAACCTTCCAGAAGAAGAGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATCAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCCAGTAGGTTTCGTTAGTTTTGACAGTCGATCAGAAGCTGAAGCAGCCAAGAATGCATTAAATGGAATCAGATTTGATCCAGAAATTCCCTCAGACATTACGCCTGGAGTTTGCAAAGGCAAACCCAAAGATGGCCAAGAGCCAGCTTGTTGGCACCCCAAATCCCAGCGCACCTCAGCTGAACAGCTTACCTCCATTTATTTCCTAGGGATCCGTATGAGCTTCACGTGGCCTGCACTTTATCCGGGTAGCCCAGAAATGGGGGGCGGCATACCCCCTCTACCCAGGGGAGTTAGCACCTGGTTCTACCTTCTTCCGGCTTTCACCTATCCCGGCTTCACTGGATGCCCCAGGGAATTGGACGGCCATTCCAGCCCCGACCTCCCCTCTTTATCCCCCCCAACCTTTTTCTAATCCTGGGTATTACAGAGGCCCTTGTAAACACTTAACAAACTTTCCCAAAAAGGATTGAACGGGAAGGGGAAACTGGATGAAAA
  5   1   2       bld FaBN 5g                         IMAGE:8077725.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGTCACTCGCAATCCCCCTTTCCTCTCTCACCCCTCGTTTTCTTTTCTTATCACTCGTACAAACCACAGACTTCCTCATTTTACTTTTTCAGAAAGAAATAGAAAAGAGCAAGAGCTTTGTTATATTATTTTGGATCTTTATGATATGCTTTTCATTAAACTAACCAGTAACCTGACTGCTTGAAATAAACTTCCAGTCTGTCTCCAGCACTTCCCAGCAGACTTTGGCTGACATTCACACAAGCTTCTTACCAAGAGACCACAATGAACAGCAACATAGCAGAAAAGGAGTGCTCCCCAGATGAGATCAACCTTCCAGAAGAAGAGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATCAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCCAGTAGGTTTCGTTAGTTTTGACAGTCGATCAGAAGCTGAAGCAGCCAAGAATGCATTAAATGGAATCAGATTTGATCCAGAAATTCCTCAGACATTACGCCTGGAGTTTGCAAAGGCAAACACAAAGATGGCCAAGAGCAAGCTTGTTGGCACCCCAAATCCCAGCGCACCTCAGCTGAACAGCTTACCTCAATTTATTTCTAGGGATCAGTATGAGCTCACAGTGCCTGCACTTTATCCCGGGTAGCCCAGAAGTGTGGGCGCCATACCCCCTCTACACAGCGGAGTTAGCACCTGCTCTACTTCT
  5   1   2       bld Tbd7 5g3  out                        XL056p21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTTTCTTTTCTTATNCTCGTACAAACCACAGGACTTCCTCATTTTACTTTTTCAGAAAGAAATAGAAAAGAGCAAGAGCTTTGTTATATTATTTTGGATCTTTATGATATGCTTTTCATTAAACTAACCAGTAACCTGACTGCTTGAAATAAACTTCCAGTCTGTCTCCAGCACTTCCCAGCAGACTTTGGCTGACATTCACACAAGCTTCTTACCAAGAGACCACAATGAACAGCAACATAGCAGAAAAGGAGTGCTCCCCAGATGAGATCAACCTTCCAGAAGAAGAGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCC
  5   1   2      seed Sp1  5g                IMAGE:4963880-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAAACCACAGACTTCCTCATTTTACTTTTTCAGAAAGAAATAGAAAAGAGCAAGAGCTTTGTTATATTATTTTGGATCTTTATGATATGCTTTTCATTAAACTAACCAGTAACCTGACTGCTTGAAATAAACTTCCAGTCTGTCTCCAGCACTTCCCAGCAGACTTTGGCTGACATTCACACAAGCTTCTTACCAAGAGACCACAATGAACAGCAACATAGCAGAAAAGGAGTGCTCCCCAGATGAGATCAACCTTCCAGAAGAAGAGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATCAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCCAGTAGGTTTCGTTAGTTTTGACAGTCGATCAGAAGCTGAAGCAGCCAAGAATGCATTAAATGGAATCAGATTTGATCCAGAAATTCCTCAGACGTTACGCCTGGAGTTTGCAAAGGCAAACACAAAGATGGCCAAGAGCAAGCTTGTTGGCACCCCAAATCCCAGCGCACCTCAGCTGAACAGCTTACCTCAATTTATTTCTAGGGATCAGTATGAGCTCACAGTGCCTGCACTTTATCCGGGTAGCCCAGAAGTGTGGGCGCCATACCCCCTCTACACAGCGGAGTTAGCACCT
  5   1   2       bld Sp1  5g3  out                   IMAGE:4963880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAACCACATGACTTCCTCATTTTACTTTTTCAGAAAGAAATAGAAAAGAGCAAGAGCTTTGTTATATTATTTTGGATCTTTATGATATGCTTTTCATTAAACTAACCAGTAACCTGACTGCTTGAAATAAACTTCCAGTCTGTCTCCAGCACTTCCCAGCAGACTTTGGCTGACATTCACACAAGCTTCTTACCAAGAGACCACAATGAACAGCAACATAGCAGAAAAGGAGTGCTCCCCAGATGAGATCAACCTTCCAGAAGAAGAGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATCAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCCAGTAGGTTTCGTTAGTTTTGACAGTCGATCAGAAGCTGAAGCAGCCAAGAATGCATTAAATGGAATCAGATTTGATCCAGAAATTCCTCAGACGTTACGCCTGGGAGTTTGCAAAGGCAAACACAAAGATGGGCAAGAGCAAGCTTTGTTGGGACCCCAAATCCCCGCG
  5   1   2       bld Tbd7                                 XL058p02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTNGGCTCTGAGGGAGGGCTATGGTCTAGGAGATAATCATTTCGATTTTCCTGTGCATCCCCCTCTTGTCTCTGTATTGAATGGATTGGGTGAGGACGCTTTTTGTCAGTGGCTTGCCTTTAGATATCAAACCTCGGGAGCTCTACTTATTATTCCGACCATTTAAGGGTTATGAAGGTTCTTTAATAAAACTCACTTCAAAGCAGCCAGTAGGTTTCGTTAGTTTTGACAGTCGATCAGAAGCTGAAGCAGCCAAGAATGCATTAAATGGAATCAGATTTGATCCAGAAATTCCTCAGACGTTACGCCTGGAGCTTGCAAAGGCAAACACAAAGATGGCCAAGAGCAAGCTTGTTGGCACCCCAAATCCCAGCGCACCTCAGCTGAACAGCTTACCTCAATTTATTTCTAGGGATCAGTATGAGCTCACAGTGCCTGCACTTTATCCGGGTAGCCCAGAAGTGTGGGCGCCATACCCCCTCTACACAGCGGAGTTAGCACCTGCTCTACCTCCTCCTGCTTTCACCTATCCTGCTTCACTGCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)