Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3396381-IMAGp.5                 8 END     3          42       37                MGC84399 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL210g19.5                            3 PI      100        11      112                MGC80264 protein [Xenopus laevis]
     3   0.0    0Xl3.1-XL211j21.3                            2 PI      100         6      116                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012780619 Xl3.1-IMAGE:6951302.5 - 7 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6951302.5                     AGGAAGAAAGTTTTGGGCCAGGCAGGATTTAGGCTCAAAGGGGGATTAGCCAGCCCCCCTTACGAGCGTGGACATCACTGATGCCGAAGACGGAAGTACAGGAACTGATGTGGATAAAATTCTGAGACCAGGCTGGACCTACTATTACTCCAGTTTCATGCTGCCTGGAGGATACAGTGATTCTATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCTTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGATGAAACAGTGACTTCATCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCGGATGACCTTCAACAGTTGAAGGAGGCCTACACCTGGTTACTTAGCAGCGTTTCTGTTCAGTTCCCATGTGGTGTACGTCAGTATACAATGGTTGAATTTAATGATCCAGGTATTGGCCCTGCCAGACTTACAAGTTCCGGAACTGAATTTAATAATTTTTTTCAAAATCTTAGAGCCTACGATGGTGGTGACTGCCCAGAATATGCAATGGGTGGACTTAAGTTGGCTTTGCAGGAATCACCCCATAATTCAATAATCATGGTCCTTACAGATGCTTCCGCTAAGGATTATAATGATGCTGTTTTAATAAATGAGATAAAATCACTTATTAGCGAAACAGAGTCACAGGTATTCTTTATGATCACTGGCCTTTGTTCAAATACAGAAGACCCAGCATTCACTATTTACAGGGAAATTTCCAGATTGAGTTTTGGCCACTTGTATCA
                                                  Xl3.1-CHK-1012700314                           AAAGTTTTGGGCCAGGCAGGATTTAGGCTCAAAGGGGGATTAGCCAGCCCCCCTTACGAGCGTGGACATCACTGATGCCGAAGACGGAAGTACAGGAACTGATGTGGATAAAATTCTGAGACCAGGCTGGACCTACTATTACTCCAGTTTCATGCTGCCTGGAGGATACAGTGATTCTATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCTTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGATGAAACAGTGACTTCATCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCGGATGACCTTCAACAGTTGAAGGAGGCCTACACCTGGTTACTTAGCAGCGTTTCTGTTCAGTTCCCATGTGGTGTACGTCAGTATACAATGGTTGAATTTAATGATCCAGGTATTGGCCCTGCCAGACTTACAAGTTCCGGAACTGAATTTAATAATTTTTTTCAAAATCTTAGAGCCTACGATGGTGGTGACTGCCCAGAATATGCAATGGGTGGACTTAAGTTGGCTTTGCAGGAATCACCCCATAATTCAATAATCATGGTCCTTACAGATGCTTCCGCTAAGGATTATAATGATGCTGTTTTAATAAATGAGATAAAATCACTTATTAGCGAAACAGAGTCACAGGTATTCTTTATGATCACTGGCCTTTGTTCAAATACAGAAGACCCAGCATTCACTATTTACAGGGAAATTTCCAGATTGAGTTTTGGCCACTTGTATCAGCTTGA
                                                      consensus depths                          2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG     226     122                     
                                               BLH MIN     313      37                     
                                               BLH MPR     121      37                     
                                               BLH OVR     226     753                     
                                               CDS MIN     226      37                     
                                               ORF LNG     226      36                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ag ==== 4e-012     XP_001687828.1 AGAP002268-PA [Anopheles gambiae str. PEST] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PREDICTED - Sp ---- 4e-015     XP_001186738.1 PREDICTED: similar to OTTHUMP00000065631 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                PREDICTED - Cf ---- 4e-024     XP_547438.2 PREDICTED: similar to High Incidence of Males (increased X chromosome loss) family member (him-4) [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 2e-024     NP_114141.2 hemicentin 1 [Homo sapiens] ----------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PREDICTED - Bt ---- 1e-024     XP_599586.3 PREDICTED: similar to OTTHUMP00000065631 [Bos taurus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 1e-024     NP_001019891.2 hemicentin 1 [Mus musculus] -------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 5e-026     XP_693306.2 PREDICTED: similar to hemicentin 1 [Danio rerio] -------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 3e-026     NP_001024582.1 High Incidence of Males (increased X chromosome loss) family member (him-4) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 1e-054     NP_001008097.1 MGC89178 protein [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 4e-083     NP_001086392.1 MGC84399 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6951302.5                                                                   TAG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TGA---TGA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2      seed Brn1 5g3  out                   IMAGE:6951302.5p TCCGGAATTCCCGGGATCAAGGAAGAAAAGTTTTGGGCCAGGCAGGATTTAGGCTCAAAGGGGGATTAGCCAGCCCCCCTTACGAGCGTGGACATCACTGATGCCGAAGACGGAAGTACAGGAACTGATGTGGATAAAATTCTGAGACCAGGCTGGACCTACTATTACTCCAGTTTCATGCTGCCTGGAGGATACAGTGATTCTATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCTTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGATGAAACAGTGACTTCATCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCGGATGACCTTCAACAGTTGAAGGAGGCCTACACCTGGTTACTTAGCAGCGTTTCTGTTCAGTTCCCATGTGGTGTACGTCAGTATACAATGGTTGAATTTAATGATCCAGGTATTGGCCCTGCCAGACTTACAAGTTCCGGAACTGAATTTAATAATTTTTTTCAAAATCTTAGAGCCTACGATGGTGGTGACTGCCCAGAATATGCAATGGGTGGACTTAAGTTGGCTTTGCAGGAATCACCCCATAATTCAATAATCATGGTCCTTACAGATGCTTCCGCTAAGGATTATAATGATGCTGTTTTAATAAATGAGATAAAATCACTTATTAGCGAAACAGAGTCACAGGTATTCTTTATGATCACTGGCCTTTGTTCAAATACAGAAGACCCAGCATTCACTATTTACAGGGAAATTTCCAGATTGAGTTTTGGCCACTTGTATCAGCTTGATCTTTCAAGTCTTGGGGAGCGCATT
  5   1   2       bld Panc 5g                         IMAGE:8737949.5p         CAGGGGGGAACAAGGAAGAAAGTTTTGGGCCAGGCAGGATTTAGGCTCAAAGGGGGATTAGCCAGCCCCCCTTACGAGCGTGGACATCACTGATGCCGAAGACGGAAGTACAGGAACTGATGTGGATAAAATTCTGAGACCAGGCTGGACCTACTATTACTCCAGTTTCATGCTGCCTGGAGGATACAGTGATTCTATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCTTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGAATGAAACAGTGACTTCATCTCCTGACTTTTCTGGTGGACACCACTGGGTTCCATGGCGGATGACCTTCACCAGTTGAAGGAAGGCTACACCTGGTACTTACACGGTTTCTGTTCGTTCCCTGTGGGGTACGTCGTATACAATGTGAGTTATGATCAGGATTGCCTGCAGACTACAGTCCGACTGATAAATTTTCAATCTAAGCTACATGTGTACGCGAATGCATTGTGACTTATGCTTCGGATCCCATTCATACTGGCTAGAGGTCCTAGATAGAGCGTTCAACGTATCTAAGGAACACGAACTCCTAATCGCGTCCCAGGGAGCGACTATAAG
  5   1   2       bld Brn1 5g                         IMAGE:6951687.5p                    AAGGAAGAAAGTTTTGGGCCAGGCAGGATTTAGGCTCAAAGGGGGATTAGCCAGCCCCCCTTACGAGCGTGGACATCACTGATGCCGAAGACGGAAGTACAGGAACTGATGTGGATAAAATTCTGAGACCAGGCTGGACCTACTATTACTCCAGTTTCATGCTGCCTGGAGGATACAGTGATTCTATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCTTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGATGAAACAGTGACTTCATCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCGGATGACCTTCAACAGTTGAAGGAGGCCTACACCTGGTTACTTAGCAGCGTTTCTGTTCAGTTCCCATGTGGTGTACGTCAGTATACAATGGTTGAATTTAATGATCCAGGTATTGGCCCTGCCAGACTTACAAGTTCCGGAACTGAATTTAATAATTTTTTTCAAAATCTTAGAGCCTACGATGGTGGTGACTGCCCAGAATATGCAATGGGTGGACTTAAGTTGGCTTTGCAGGAATCACCCCATAATTCAATAATCATGGTCCCTTACAGATGCTTTCCGCTAAGGATTATAAATGATGGCTGGTTTTTAATAAAATGGAGAATAAAATTCCCCTTTATTATGCCGAAAACAGAAATCCACAAGGGTATTTCCCTTTATGAATCAACTGGGCCCTTTTTGTTTCCAAATTACCCGGAAGGAAACCCCGGNCCATTTTCACCTTATTTTTTACAAGGGGGAGAAAATTTTCCCCCCGAGATATTGGAAGAttttttttggggccccccccTCTGGTGTTAATCTCAGCCCT
  5   1   2       bld Brn1 5g                         IMAGE:7018781.5p                                                                                                                                              CTGAGACCAGGCTGGACCTACTATTACTCCAGTTTCATGCTGCCTGGAGGATACAGTGATTCTATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCTTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGATGAAACAGTGACTTCATCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCGGATGACCTTCAACAGTTGAAGGAGGCCTACACCTGGTTACTTAGCAGCGTTTCTGTTCAGTTCCCATGTGGTGTACGTCAGTATACAATGGTTGAATTTAATGATCCAGGTATTGGCCCTGCCAGACTTACAAGTTCCGGAACTGAATTTAATAATTTTTTTCAAAATCTTAGAGCCTACGATGGTGGTGACTGCCCAGAATATGCAATGGGTGGACTTAAGTTGGCTTTGCAGGAATCACCCCATAATTCAATAATCATGGTCCTTACAGATGCTTCCGCTAAGGATTATAATGATGCTGTTTTAATAAATGAGATAAAATCACTTATTAGCGAAACAGAGTCACAGGTATTCTTTATGATCACTGGCCTTTGTTCAAATACAGAAGACCCAGCATTCACTATTTACAGGGAAATTTCCAGATTGAGTTTTGGCCACTTGTATCAGCTTGATCTTCCAAGTCTTGGGAGCGCATTTCGATATGTGGGATCTATTATAGCAAGACCTGCAAAATCTTCTCAGAGGATTTTTTCTAGAGATTATGAGTCTGGTGAGCATTCAGACACTTTTCTCTGTTCCCAAANAAGTTTAACTGAAA
  5   1   2       bld Li1  5g3  out                   IMAGE:3397021.5p                                                                                                                                                                                     CTGCCTGGAGGATACAGTGATTCTATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCCTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGATGAAACAGTGACTTCATCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCGGATGACCTTCAACAGTTGAAGGAGGCCTACACCTGGTTACTTAGCAGCGTTTCTGTTCAGTTCCCATGTGGTGTACGTCAGTATACAATGGTTGAATTTAATGATCCAGGTATTGGCCCTGCCAGACTTACAAGTTCCGGAACTGAATTTAATAATTTTTTTCAAAATCTTAGAGCCTACGATGGTGGTGACTGCCCAGAATATGCAATGGGTGGACTTAAGTTGGCTTTGCAGGAATCACCCCATAATTCAATAATCATGGTCCTTACAGATGCTGCCGCTTAGGATTATAAT
  5   1   2       bld Li1  5g3  out                   IMAGE:3396794.5p                                                                                                                                                                                                 TACAGTGATTCTATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCCTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGATGAAACAGTGACTTCATCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCGGATGACCTTCAACAGTTGAAGGAGGCCTACACCTGGTTACTTAGCAGCGTTTCTGTTCAG
  5   1   2       bld Li1  5g                         IMAGE:3396937.5p                                                                                                                                                                                                             ATTACACAGTTTAGATATCACTGAGTTTGAAAAGAATTTATCATGAAAACTTGCTCCAGCTTTCTCTTACTCCTCTTCAGTGGCTGGGCATTTTCTGCAACAAAATGGAAGCGAGATGTGCTTTTGGAGCCTAAAACGTCCCTAGAATGTGATGATGAAACAGTGACTTCAATCTCTGACTTTTCTGGTGGACACCACTGGTTCCATGGCGGATGACCTTCAACAGTTGAAGGAGGCCTACACCTGGTTACTTAGCAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)