Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.6699999999999999    0Xl3.1-XL092n24.3                            3 END     3          42      100                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012780667 Xl3.1-IMAGE:8318012.5 - 7 ESTs
                                                                       ....-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8318012.5                                                                                                                                                                               CTTCTCCTAATTCCTCCCCAAAATGTCCTTTCCCAACAGCTCTCCTGCTGCAAATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCAAAAAGAGAAATCAATCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCAGCTCCCCACTTGCTCCTTTCCTACCAACATTAAGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGTCCTCGTACCCGAGGCTGGTGCCTGACAACTGTCCTGTGGAGAACTCAGAGGTGCCAGTCCCAGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGCAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCTCAACCCTCGTCGCTCCAGCTCACAGCAGATCCCTCCTCAACTTCACATGGACAAGAAAATGAATGAGAATCCGGCCAGCCAAGACTCATGCAAAGTCCCATCTGGGGAGAGTCCCGACCCCAAGTCTGC
                                                  Xl3.1-CHK-1012699838                                                                                                                                                                                     CTAATTCCTCCCCAAAATGTCCTTTCCCAACAGCTCTCCTGCTGCAAATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCAAAAAGAGAAATCAATCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCAGCTCCCCACTTGCTCCTTTCCTACCAACATTAAGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGTCCTCGTACCCGAGGCTGGTGCCTGACAACTGTCCTGTGGAGAACTCAGAGGTGCCAGTCCCAGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGCAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCTCAACCCTCGxxxCxxCxxCxxACAGCAGATCCCTCCTCAACTTCACATGGACAAGAAAATGAATGAGAATCCGGCCAGCCAAGACTCATGCAAAGTCCCATCTGGGGAGAGTCCCGACCCCAAGTCTGCGCTGCA
                                                      consensus depths                                                                                                                                                                                    4     5     5     6     5     6     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     7     7     7     7     7     7     7     7     5     7     5     7     5     7     5     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     2     7     3     7     2     7     2     6     2     6     2     6     2     4     2     4     2     4     2     4     2     4
                                               BLH ATG      22     454                                                                                                                                                                               
                                               BLH MIN      22      69                                                                                                                                                                               
                                               BLH MPR      22      69                                                                                                                                                                               
                                               BLH OVR      22     409                                                                                                                                                                               
                                               EST CLI     -10       1                                                                                                                                                                               
                                               ORF LNG      22      24                                                                                                                                                                               
                                                                                                                                                                                                                                                                           PROTEIN === Dr ==== 2e-065     NP_571241.1 homeo box D10a; homeobox gene D-10 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 7e-086     XP_001234539.1 PREDICTED: similar to homeobox D10 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 8e-099     NP_038582.2 homeo box D10 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PREDICTED = Cf ==== 7e-099     XP_545537.2 PREDICTED: similar to homeo box D10 [Canis familiaris] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 6e-099     NP_002139.2 homeo box D10 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Bt ==== 1e-099     NP_001092575.1 homeobox D10 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 4e-128     NP_001083635.1 homeo box D10 [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8318012.5                                                                                                                                                                                      TAA------------ATG------------------------------------------------------------------------------------------------ATG---ATG------------------------------ATG------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------ATG
                                                                   ORF                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       add Kid                             IMAGE:4032032.5p TGGCGAGAAANAGTGGAATGAAATGGTGATTGTGTGAGGTGAGGGATGGGGGGTGGGGATTCTGATGATAGATTATGAAACATTAAAATTATACAACCCCACTACTCCATCAGAGCGGTGAAGATGGGTGGAGGGGGAGCCTAATGCGATAGAAGTTggaaaatgtgaaaaaagaaaagagagggagaaaaaaaaaaGGAAGGAGAAGCCTTTCTCTCCTGCTGCNNATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCNNANAGAGAATTCCTTCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCAGCTCCCCACTTGCTCCTTTCCTACCNACATTNNGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGTCCTCGTACCCGAGGCTGGTGCCTGACAACTGTCCTGTGGAGAACTCANAGGTGCCAGTCCCNGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGCAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCCTCAACCCCTTCGCTCCAGNCTCCANAACCAGCCAGATTCCCCTCCTTCAAACTTTTCACCTTTGGGACAAAGNNAAAAATTGAATTGAAGNAAATCCCCNGGNCCCAGCCTCCAAAGGACCCTCCCATTNGGCCCAAAAGGTTTCCCCCCAATTTCCTTTGGGGGGGGAAGGAAGGTTcccccccgaaaccccccccccTAAGTTCCTTTGCCCCNCCTTTGCCCAGGGGGAAGTGNAACCCAAGGGAAAGCCCTTGCCCCCCTTGGGGCCTTTGAAGGGGTTGGTTCCCTGTTTGTTTCCCCAGGccccccccGNAAAAGTTTTGCCANGGGAACCCAGTGGGAAGNACCCTTAAAAGAAGGGTAAAAATTCCTAAgtttccccgaattacccccccnaacccaaagccccaatttttggtttttaaccctgccccAAAAGAAATTTGGCCCTGAAANCAGNAAAGGAGAGTTTGTTccccttttttacccaaaacccccccagaaaccccttttgaaactttttGCGGAAAAGGGAAATTTCCCTTC
  5   1   2       bld Tbd7 5g3  out                        XL104l07.5p                                                                                                                   GCACAATTACACAGGGNAATGTTTTGCTAGAGATGTCAGCCTACAAAGGACACAATCCCTCTTCTCCTAATTCCTCCCCAAAATGTCCTTTCCCAACAGCTCTCCTGCTGCAAATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCAAAAAGAGAAGTCAATCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCATCTCCCTACTTGCTCCTTTCCCACCAACATTAAGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGGGCCCATCATACCAGAGGCTGCTGCCTGACAACTGTCCTGTGGAGAACTCAGAGGTGCCAGTCCCAGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGGAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCTCAACCCTCGCTCCAGCTCCAAACAGCAGATC
  5   1   2       bld Tbd7 5g3  out                        XL092n24.5p                                                                                                                                                                     CACAATCCCTCTTCTCCTAATTCCTCCCCAAAATGTCCTTTCCCAACAGCTCTCCTGCTGCAAATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCAAAAAGAGAAGTCAATCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCATCTCCCTACTTGCTCCTTTCCCACCAACATTAAGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGGGCCCATCATACCAGAGGCTGCTGCCTGACAACTGTCCTGTGGAGAACTCAGAGGTGCCAGTCCCAGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGGAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCTCAACCCTCGCTCCAGCTCCAAACAGCAGATCCCTCCTCAACTTCACATGGACAAGAAAATGAATGAGAATCCGG
  5   1   2       bld Neu5 5g                           Neu5-120G14.5p                                                                                                                                                                        AATCCCTCTTCTCCTAATTCCTCCCCAAAATGTCCTTTCCCAACAGCTCTCCTGCTGCAAATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCAAAAAGAGAAATCAATCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCAGCTCCCCACTTGCTCCTTTCCTACCAACATTAAGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGTCCTCGTACCCGAGGCTGGTGCCTGACAACTGTCCTGTGGAGAACTCAGAGGTGCCAGTCCCAGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGCAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCTTCAACCCTCGCTCCAGCTCCAAACAGCAGATCCCTCCTCAACTTCACATGGACAAGGAAAAATGAATGAGAATCCGGCCAGCCAAGACTCATGCCAAAGGTCCCCATCTGGGGGAGGAGTTCCCGAGCCCAAGTCTGGCGCCTGCAGGAAGGACAGGGAGCTGGCCTGGCTGGAGGTGTCTGGTGTCCAGCCCAAAAAGTGGCAGGGACCAAGGGAGACTTAAAGGAGGAAATCAAGTTCCCGAATACCCCCCAAACAAGGCCAATTGGGTTAACTGGcaaaaagtggccaaaaagaaaaaaGGGGGTCCC
  5   1   2      seed Em10 5g                         IMAGE:8318012.5p                                                                                                                                                                           CCCTCTTCTCCTAATTCCTCCCCAAAATGTCCTTTCCCAACAGCTCTCCTGCTGCAAATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCAAAAAGAGAAATCAATCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCAGCTCCCCACTTGCTCCTTTCCTACCAACATTAAGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGTCCTCGTACCCGAGGCTGGTGCCTGACAACTGTCCTGTGGAGAACTCAGAGGTGCCAGTCCCAGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGCAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCTCAACCCTCGCTCCAGCTCCAAACAGCAGATCCCTCCTCAACTTCACATGGACAAGAAAATGAATGAGAATCCGGCCAGCCAAGACTCATGCAAAGTCCCATCTGGGGAGAGTCCCGACCCCAAGTCTGCGCTGCAGGA
  5   1   2       bld Kid  5g                IMAGE:4032032-IMAGp.IMAGp                                                                                                                                                                                          TCCTCCCCAAAATGTCCTTTCCCAACAGCTCTCCTGCTGCAAATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCAAAAAGAGAAATCAATCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCAGCTCCCCACTTGCTCCTTTCCTACCAACATTAAGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGTCCTCGTACCCGAGGCTGGTGCCTGACAACTGTCCTGTGGAGAACTCAGAGGTGCCAGTCCCAGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGCAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCTCAACCCTCGCTCCAGCTCCAAACAGCAGATCCCTCCTCAACTTCACATGGACAAGAAAATGAATGAGAATCCGGCCAGCCAAGACTCATGCAAAGTCCCATCTGGGGAGAGTCCCGACCCCAAGTCTGCGCTGCAGGAGGACAGGAGCTGCCTGGCTGAGGTGTCTGTGTCCAGCCCAGAAGTGCAGGACAAGGAGACTAAAGAGGAAATCAAGTCCGATACCCCAACAAGCAATTGGTTAACTGCAAAGAGTGGCAGAAAGAAGAGGTGTCCCTATACCAAACACCAGACATTGGAGTTAGAGAAGGAATTCTTGTTTAATATGTATCTGAC
  5   1   2       bld Tbd7      out                        XL073p12.5p                                                                                                                                                                                                        TCCTTTCCCAACAGCTCTCCTGCTGCAAATACTTTTTTAGTAGATTCCTTGATCAGTGCCTGTAGAAGTGACAGTTTCTATTCTAACAGCGCCAGCATGTACATGCCACCCAGCACAGAGATTGGCACTTATGGCATGCAAACCTGTGGACTGCTACCCTCTCTGGCAAAAAGAGAAATCAATCACCAAAACATGGGCATGAATGTGCATCCCTATATACCTCAAGTAGACTCTTGGACTGATCCGAGCAGGTCCTGTAGGATAGAACAACCTGTTACACAGCAGCTCCCCACTTGCTCCTTTCCTACCAACATTAAGGAGGAGACCAACTGCTGCATGTATTCTGATAAGAGATCCAAAGTGATTTCTGCAGAGTCCTCGTACCCGAGGCTGGTGCCTGACAACTGTCCTGTGGAGAACTCAGGTGCCAGTCCCAGGATATTTCAGGCTGAGCCAGAGCTACGCCACCGGCAAACCCCAAGAGTACAATAATAACCCAGAAAGCAGCTCATCCCTAATGTTACAGCTCAACCCTCGCTCCAGCTCCAAACAGCAGATCCCTCCTCAACTTCACATGGACAAGAAAATGAATGAGAATCCGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)