Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3401746-IMAGp.5.5              39 END     1          16        2                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3401746-IMAGp.5.5              39 PI      90        347      482                (no blast hit)
     3   0.0    0Xl3.1-xl290i16.5                            3 PI      92        148      816                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012780703 Xl3.1-XL423k14ex.5 - 6 ESTs
                                                                       ...-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL423k14ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGCCTTCCACTGCATCCGACATCAGGAATAATTCAGGACCAACACTGCTGCATTTAAAGGACTGACCATTAGAATCTCTCTTCATTCTTTTGACTTGCTTTTTATGATTTGAATTGGGAATACTCTATCTAATGTTCTGTATTTGGCCCCCCCCGAGATTCAGTTTGACAGACCCTTAAAATTTGGCTAACCGAATCAAAACTTTTGTTTTTCTATGATTTTCTTTTGGGCCAAAGAATTGCTAAGGCCAATTCACTCATGGTAATATGCAACTTCATTTTGGTGTACAGACTAAACTTTGATGGAGCCGTCAATAGTGGATTGAACCCTGAAATTTTGAATTTATTAAGAATATGTTCTCTCATATCTGTGTCTTCATACTTGTGCTTGACATTTCTATGGGGGAGCAAGAGGTGTGCCCCTTGTAAGGGCTCAGATTGTCGGTTCGCACAGCACCTCACATGTAATAAAAAAGTTTGTTTTGTTTTTTAGTCTTTATTTCCTTTGATAATAAGCTCTCTATGCATAGGTTGTCCTTTCATCAAAGATGAGGGGCCCATGCTAGTATGGTCCTAGGTATTAGATGGAGTAGAGGTGCAGTATGATCAGTAAAGTTATACAGACGATAGGTTGTTGTATACATTGTAAGCAACTTTGAATTTAGTGTAAGGCATTGTTGCTAAAAATTATTATTTTGGATTTGGCCGAATCCTTCTTGAAAGTTTCGGCCGATTACCGAACCGAATCCGAACCCTAATTTGCATATGCAAATTGGGGGTGGAAAAGGGAAAACATTTATACCTTTGTTTTGTGAC
                                                  Xl3.1-CHK-1012702839                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCACTGCATCCGACATCAGGAATAATTCAGGACCAACACTGCTGCATTTAAAGGACTGACCATTAGAATCTCTCTTCATTCTTTTGACTTGCTTTTTATGATTTGAATTGGGAATACTCTATCTAATGTTCTGTATTTGGCCCCCCCCGAGATTCAGTTTGACAGACCCTTAAAATTTGGCTAACCGAATCAAAACTTTTGTTTTTCTATGATTTTCTTTTGGGCCAAAGAATTGCTAAGGCCAATTCACTCATGGTAATATGCAACTTCATTTTGGTGTACAGACTAAACTTTGATGGAGCCGTCAATAGTGGATTGAACCCTGAAATTTTGAATTTATTAAGAATATGTTCTCTCATATCTGTGTCTTCATACTTGTGCTTGACATTTCTATGGGGGAGCAAGAGGTGTGCCCCTTGTAAGGGCTCAGATTGTCGGTTCGCACAGCACCTCACATGTAATAAAAAAGTTTGTTTTGTTTTTTAGTCTTTATTTCCTTTGATAATAAGCTCTCTATGCATAGGTTGTCCTTTCATCAAAGATGAGGGGCCCATGCTAGTATGGTCCTAGGTATTAGATGGAGTAGAGGTGCAGTATGATCAGTAAAGTTATACAGACGATAGGTTGTTGTATACATTGTAAGCAACTTTGAATTTAGTGTAAGGCATTGTTGCTAAAAATTATTATTTTGGATTTGGCCGAATCCTTCTTGAAAGTTTCGGCCGATTACCGAACCGAATCCGAACCCTAATTTGCATATGCAAATTGGGGGTGGAAAAGGGAAAACATTTATACCTTTGTTTTGTGACAAAAGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     4     5     4     5     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     5     5     5     5     5     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------A--
                                                    Xl3.1-XL423k14ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAA------------TAG------------------TGA------------------------------------TAA---------------------------------TGA------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------ATG------------TAG---------------------------------TAA---------------------------------TAA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                  ]
  3   1   2       bld Ga18                              rxlk64b16ex.3p ANNATGAGNCCATTCTGGCATCCAGNGNNNCTGNCNGTANNNTAAATGTTTGGGNTTNAAGTAAAATAGNNNANGNGNAATCTNCTGANGATGCNNNAAGATGGTCCCCTNNNCTTCTGTTTNTTCATGGTGGTCANACAGCCAAGATNTCAGNCTTCTCATGGANTCCTANTGAACNATGGGTGATCTGTTCGNTATCTGAGGANANNNTCATGCAGNTCTGGCAAATNNCGGAGAACNTTTATAATGATGNAGATACAGAGGGTGGTGTTGATCCAGAGGGTCAAGGTTCCTAGACAAAGATATACTGTTCTGTCTGTTTCTTGCAAAAACAGAGATTGTGTCTTCTGCATCCAGCACTTAGACATCGNCCATTCAATGCTGCACAGAGCTGCTTCTGGCTCCTCCTCTTCCCCCCTGCGTTCTAATCTCGCTTTCACTGGTTTTTTTGAGGAATCCCCTTTTATTTTATATATATATATATATATATATATATTATTTTATATAAAATTCTCATTTTAACCACGTATCTGNNNNNAGGCGTTTTTAGAATCAAGGAGGGGGAGAGAGCCCATTGTCTGACTCACAGGCTGGATTCCCCCAGTGCCTTCCACTGCATCCGACATCAGGAATAATTCAGGACCAACACTGCTGCATTTAAAGGACTGACCATTAGAATCTCTCTTCATTCTTTTGACTTGCTTTTTATGATTTGAATTGGGAATACTCTATCTAATGTTCTGTATTTGGCCCCCCCCGAGATTCAGTTTGACAGACCCTTAAAATTTGGCTAACCGAATCAAAACTTTTGTTTTTCTATGATTTTCTTTTGGGCCAAAGAATTGCTAAGGCCAATTCACTCATGGTAATATGCAACTTCATTTTGGTGTACAGACTAAACTTTGATGGAGCCGTCAATAGTGGATTGAACCCTGAAATTTTGAATTTATTAAGAATATGTTCTCTCATATCTGTGTCTTCATACTTGTGCTTGACATTTCTATGGGGGAGCAAGAGGTGTNCCCCTTGTAAGGGCTCAGATTGTCGNNT
  3   1   2       bld Emb1 5g3  out                   IMAGE:3401746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTTATATAATACACATATAATATTGTTATTTATATAAATTTTCATTTACCAAGTATTTGTGCAAGGCGTTTTAGATCAAGAGGCGGAGAGAGAGCCCATTGTCTGACTCACAGGNTGGATTCCCCCAAGTGCCTTCCACTGCATCTGACATCAGCAATAATTCAGGACCAACACTGCTGCATTTAAAGGACTGACCATTAGAATCTCTCTTCATTCTTTTGACTTGCTTTTTATGATTTGAATTGGGAATACTCTATCTAATGTTCTGTATTTGGCCCCCCCCCCGAGATTCAGTTTGACAGACCCTTAAAATTTGGCTAACCGAATCAAAACTTTTGTTTTTCTATGATTTTCTTTTGGGCCAAAGAATTGCTAAGGCCAATTCACTCATGGTAATATGCAACTTCATTTTGGTATACAGACTAAACTTTGATGGAGCCGTCAATAGTGGATTGAACCCTGAAATTTTGAATTTATTAAGAATATGTTCTCTCATATCTGTGTCTTCATACTTGTGCTTGACATTTCTATGGGGGAGCAAGAGGTGTGCCCCTTGTAAGGGCTCAGATTGTCGGTTCGCACAGCACCTCACATGTAATAAAAAAGTTTGTTTTGTTAA
  5   1   2      seed Ga15                               XL423k14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCAGTGCCTTCCACTGCATCCGACATCAGGAATAATTCAGGACCAACACTGCTGCATTTAAAGGACTGACCATTAGAATCTCTCTTCATTCTTTTGACTTGCTTTTTATGATTTGAATTGGGAATACTCTATCTAATGTTCTGTATTTGGccccccccGAGATTCAGTTTGACAGACCCTTAAAATTTGGCTAACCGAATCAAAACTTTTGTTTTTCTATGATTTTCTTTTGGGCCAAAGAATTGCTAAGGCCAATTCACTCATGGTAATATGCAACTTCATTTTGGTGTACAGACTAAACTTTGATGGAGCCGTCAATAGTGGATTGAACCCTGAAATTTTGAATTTATTAAGAATATGTTCTCTCATATCTGTGTCTTCATACTTGTGCTTGACATTTCTATGGGGGAGCAAGAGGTGTGCCCCTTGTAAGGGCTCAGATTGTCGGTTCGCACAGCACCTCACATGTAATAAAAAAgtttgttttgttttttAGTCTTTATTTCCTTTGATAATAAGCTCTCTATGCATAGGTTGTCCTTTCATCAAAGATGAGGGGCCCATGCTAGTATGGTCCTAGGTATTAGATGGAGTAGAGGTGCAGTATGATCAGTAAAGTTATACAGACGATAGGTTGTTGTATACATTGTAAGCAACTTTGAATTTAGTGTAAGGCATTGTTGCTAAAAATTATtattttggatttggccgaacccccgaatccttcttgaaagtttcg
  3   1   2       bld Emb4                            IMAGE:4203154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTGCATTTAAAGGACTGACCATTAGAATCTCTCTTCATTCTTTTGACCTGCTTTTTATGATTTGAATTGGGAATACTCTATCTAATGTTCTGTATTTGGCCCCCCCCGAGATTCAGTTTGACAGACCCTTAAAATTTGGCTAACCGAATCAAAACTTTTGTTTTTCTATGATTTTCTTTTGGGCCAAAGAATTGCTAAGGCCAATTCACTCATGGTAATAAGCAACTTCATTTTGGTGTACAGACTAAACTTTGATGGAGCCGTCAATAGTGGATTGAACCCTGAAATTTTGAATTTATTAAGAATATGTTCTCTCATATCTGTGTCTTCATACTTGTGCTTGACATTTCTATGAGGGAGCAAGAGGTGTGCCCCTTGTAAGGGCTCAGATTGTCGGTTCGCACAGCACCTCACATGTAATAAAAAAGTTTGTTTTGAAAAAAAAAAAAAAA
  3   1   2       bld Ga18                             rxlk130f17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNNCAGGAANNNTNCNCCCCNNNNNNNGAGATTCANNTNNCAGNCCCTTAAANTTTGGCTAACCGAATCAAAACTTTTGTTTTTCTATGATTTTCTTTTGGNCCAAAGAATTGCTAAGGCCAATTCNCTCATGGTAATTTGCAACTTCATTTTGGTATACAGACTAANCTTTGATGGAGCCGTCAATAGTGGATTGANCCCTGAANTTTTGAATTTATTAAGAATATGTTCTCTCATATCTGTGTCTTCATACTTGTGCTTGACATTTCTATGGGGGAGCAAGAGGTGTGCCCCTTGTAAGGGCTCAGATTGTCGGTTNNNACAGCNCCTCACATGTAATAAAAAAGTTTGTTTTGTTTTTTAGTCTTTATTTCCTTTGATAATAAGCTCTCTATGCATAGGTTGTCCTTTCATCAAAGATGAGGGNCCCATGCTAGTATGGTCCTAGGTATTAGATGGAGTAGAGGTGCAGTATGATCAGTAAAGTTATACAGACGATAGGTTGTTGTATACATTGTAAGCAACTTTGAATTTAGTGTAAGGCATTGTTGCTAAAAATTATTATTTTGGATTTGGCCGAATCCTTCTTGAAAGTTTCGGCCGATTACCGAACCGAATCCGAACCCTAATTTGCATATGCAAATTGGGGGTGGAAAAGGGAAAACATTTATACCTTTGTTTTGTGACAAAAGTGAAGCTATTTCCCTCCCGGCCCCTAATnnnAnnCGCAAATTAGGATTTGGTTCGGCCGAATCCTGCTTTAAAAGGCCAAATCCCGAACCGAATCTTGGATTCAGTGCATCCCTACTAAAAATCCAAAATCAATCAGCTTAGTCCAATGTAAAATGTTTCCATTTATTCAGGGACGATTCTGAGCCCTCGTCTTACAAGGGGCCATCTCAATNTCCTCATGGCAGGGGTGTCAGTGCTTTTATCTTGTAAAGGTGTAAGGTTTGTTGTGAACAGTTTGAAANCTTTCTGTGTATGCAGAAATACAGCTG
  5   1   2       bld DMZ                                  xl241o15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAGAACTAGTCTCGAGTTTTTCTATGATTTTCTTTTGGGCCAAAGAATTGCTAAGGCCAATTCACTCATGGTAATTTGCAACTTCATTTTGGTATACAGACTAAACTTTGATGGAGCCGTCAATAGTGGATTGAACCCTGAAATTTTGAATTTATTAAGAATATGTTCTCTCATATCTGTGTCTTCATACTTGTGCTTGACATTTCTATGGGGGAGCAAGAGGTGTGCCCCTTGTAAGGGCTCAGATTGTCGGTTCGCACAGCACCTCACATGTAATAAAAAAgtttgttttgttttttAGTCTTTATTTCCTTTGATAATAAGCTCTCTATGCATAGGTTGTCCTTTCATCAAAGATGAGGGGCCCATGCTAGTATGGTCCTAGGTATTAGATGGAGTAGAGGTGCAGTATGATCAGTAAAGTTATACAGACGATAGGTTGTTGTATACATTGTAAGCAACTTTGAATTTAGTGTAAGGCATTGTTGCTAAAAATTATTATTTTGGATTTGGccgaatccttcttgaaagtttcggccgattaccgaaccgaatccgaaccctaatttgcatatgcaaattgggggtggaaaagggaaaacatttatacctttgttttgtgacaaaggtgaagctatttcccctcccggcccctaatttgcatacgcaaattggg

In case of problems mail me! (mike.gilchrist@crick.ac.uk)