Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL072o20.5                            5 END     1          16       20                protein kinase, cAMP-dependent, catalytic, beta [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:3436928-IMAGp.5.5              34 PI      76         91      744                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6641681.5                       2 PI      94         81      559                cAMP-dependent protein kinase catalytic subunit alpha [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012780747 Xl3.1-IMAGE:3377963-IMAGp.5 - 6 ESTs
                                                                       .-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3377963-IMAGp.5                                                                                                      AGCCAGCAGGCCCGTCTTATCGCTTCCCACAGGTCTTAAAATTATCGGTGGGGGGCGTTTGTCCAGAACTTAGAGGACCCGTCCGCCCCCCACCATGGGCAACGCGGCTACCGCGAAGAAGGGGGGCGAGATTGAAAGCGTGAAAGAATTTCTGGCCAAAGCAAAAGAAGATTTTCTGAAAAAATGGGAGAATCCAGCACAGAACACGGCTCACCTGGACCAGTTTGAGCGAATTAAAACCCTTGGCACTGGGTCGTTTGGGCGAGTAATGCTGGTCAGACAAAAAGAAAATGGCAGTCACTTTGCTATGAAGATCTTGGACAAGCAGAAGGTGGTGAAGTTGAAGCAGATTGAGCACACTTTGAATGAGAAACGGATCCTGCAGGCTGTGAATTTCCCATTCCTTGTGCGGCTGGAGTATTCATTTAAGGATAACAGCAATCTGTATATGGTCATGGAGTATGTAGCCGGCGGGGAGATGTTCTCTCATTTGCGCAGAATCGGGCGCTTCAGTGAACCTCACGCACGCTTCTATGCATCCCAGATTGTATTAACTTTTGAATATCTGCATGCCCTGGATCTTATATACAGAGACTTGAAGCCAGAGAATCTTCTCATAGACCAACAGGGATACATCCAGGTGACAGATTTTGGCTTTGCAAAGAGAGTGAAAGGGAGGACCTGGACCCTGTGTGGGACCCCCGAGTACCTTGCGCCAGAAATAATCCTTAGCAAGGGTTATAA
                                                  Xl3.1-CHK-1012702944                                                                                                            CAGGCCCGTCTTATCGCTTCCCACAGGTCTTAAAATTATCGGTGGGGGGCGTTTGTCCAGAACTTAGAGGACCCGTCCGCCCCCCACCATGGGCAACGCGGCTACCGCGAAGAAGGGGGGCGAGATTGAAAGCGTGAAAGAATTTCTGGCCAAAGCAAAAGAAGATTTTCTGAAAAAATGGGAGAATCCAGCACAGAACACGGCTCACCTGGACCAGTTTGAGCGAATTAAAACCCTTGGCACTGGGTCGTTTGGGCGAGTAATGCTGGTCAGACAAAAAGAAAATGGCAGTCACTTTGCTATGAAGATCTTGGACAAGCAGAAGGTGGTGAAGTTGAAGCAGATTGAGCACACTTTGAATGAGAAACGGATCCTGCAGGCTGTGAATTTCCCATTCCTTGTGCGGCTGGAGTATTCATTTAAGGATAACAGCAATCTGTATATGGTCATGGAGTATGTAGCCGGCGGGGAGATGTTCTCTCATTTGCGCAGAATCGGGCGCTTCAGTGAACCTCACGCACGCTTCTATGCATCCCAGATTGTATTAACTTTTGAATATCTGCACGCCCTGGATCTTATATACAGAGACTTGAAGCCAGAGAATCTTCTCATAGACCAACAGGGATACATCCAGGTGACAGATTTTGGCTTTGCAAAGAGAGTGAAAGGGAGGACCTGGACCCTGTGTGGGACCCCCGAGTACCTTGCGCCAGAAATAATCCTTAGCAAGGGTTATAATAAGGC
                                                      consensus depths                                                                                                           2     4     2     4     2     4     3     5     3     5     4     6     4     6     4     6     4     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      94     400                                                                                                      
                                               BLH MIN      94     138                                                                                                      
                                               BLH OVR      94     476                                                                                                      
                                               ORF LNG      94      16                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 1e-027     NP_001027631.1 calmodulin-dependent protein kinase homologue [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN === Ag ==== 5e-070     XP_321752.3 AGAP001384-PA [Anopheles gambiae str. PEST] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PREDICTED = Sp ==== 5e-093     XP_001175934.1 PREDICTED: similar to catalytic subunit of cAMP-dependent histone kinase isoform 1 [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN === Dm ==== 1e-095     NP_995672.1 CG4379-PC, isoform C [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Ce ---- 2e-100     NP_740959.1 cyclic AMP-dependent catalytic subunit (44.6 kD) (kin-1) [Caenorhabditiselegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PREDICTED - Gg ---- 9e-104     XP_422379.1 PREDICTED: similar to cAMP-dependent protein kinase catalytic subunit beta isoform 1; PKA C-beta [Gallus gallus] ------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PREDICTED = Dr ==== 6e-113     NP_001076309.1 hypothetical protein LOC564064 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 2e-114     NP_032880.1 protein kinase, cAMP dependent, catalytic, alpha; C alpha [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN === Cf ==== 6e-115     NP_001003032.1 cAMP-dependent protein kinase catalytic subunit alpha [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN === Bt ==== 2e-115     NP_777009.1 protein kinase, cAMP-dependent, catalytic, alpha [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 2e-115     NP_002721.1 protein kinase, cAMP-dependent, catalytic, alpha [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 2e-121     CAJ81681.1 protein kinase, cAMP dependent, catalytic, alpha [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 2e-122     NP_001086667.1 protein kinase, cAMP-dependent, catalytic, beta [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3377963-IMAGp.5                                                                                                                                                                            TAG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------ATG
                                                                   ORF                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2       bld Emb4 5g                         IMAGE:4679867.5p CACGCTTCCGCCAACGCGTCCGCGGACGCGTGGGTCGGATTCGAAACGGTTTGTCCAGGGGGCGGGAGGGGCTACGTACCGTGATTGGGTGACAAGGTTTGAGTGACGACGAACAAGGCGGAGCTAATCAGGTCTTAAAATTATCGGTGGGGGGCGTTTGTCCAGAACTTAGAGGACCCGTCCGCCCCCCACCATGGGCAACGCGGCTATCTGTTGAAGAAGGGGGGCGAGATTGAAAGCGTGAAAGAATTTCTGGCCAAAGCAAAAGAAGATTTTCTGAAAAAATGGGAGAATCCAGCACAGAACACGGCTCACCTGGACCAGTTTGAGCGAATTAAAACCCTTGGCACTGGGTCGTTTGGGCGAGTAATGCTGGTCAGACAAAAAGAAAATGGCAGTCACTTTGCTATGAAGATCTTGGACAAGCAGAAGGTGGTGAAGTTGAAGCAGATTGAGCACACTTTGAATGAGAAACGGATCCTGCAGGCTGTGAATTTCCCATTCCTTGTGCGGCTGGAGTATTCATTTAAGGATAACAGCAATCTGTACATGGTCATGGAGTATGTAGCCGGCGGGGAC
  5   1   2       add Ga18                               xlk78m20ex.5p                  GANNTTCNNNAGGAGGAGGGAAAAGGTTCCGCGGCCTGNNGTTCTAGAGGTGACGAGCGGGTNCTGGATGCGTCCGGTGGGAGGAGAGCCAGCAGNNNGTCATATCGCTTCCCAGAGGTCTTAAACTTATTGGTGGGGGGCGTTTGTCCAGAATTTAGAGGACCCGTCCGCCCCCCACCATGGGCNANNNNCTACCACAAAGAAGGGTGGCGAGATTGAAAGTGTGAAAGAATTTCTGGCAAAAGCAAAAGAAGATTTTCTGAAAAAATGGGAGAGTCCAGCACAGAACACAGCAAATCTGGACCAGTTTGAGCGAATGAAAACTCTTGGCACCGGGTCGTTTGGGCGCGTAATGNTGGTCAGGCACAAAGAAAATGGCAGTCACTTTGCTATGAAAATCTTGGACAAGCAGAAGGTGGTGAAGTTGAAGCAGATTGAGCACACGTTGAATGAGAAACGGATACTGCAGGCTGTGAATTTCCCATTCCTTGTGCGGCTGGAGTATTCGTTTAAGGATAACACCAATCTGTATATGGTCATGGAGTATGTAGCCGGNGGGGAGATGTTCTCTCATTTGCGCAGAATCGGGCGCTTCAGTGAACCTCATGCACGCTTCTATGCATCCCAGATTGTATTAACTTTCGAATATCTACACGCCCTGGATCTTATATACAGAGACTTGAAGCCAGAGAATCTTCTCATAGANCAGCAGG
  5   1   2       bld Em10 5g                         IMAGE:8319090.5p                     GGAAAGGCTCCGCGGCCTGCGGGGTTCTAGAGGTGAAAAGGGAGGCGGCGAGCGGGTGCTGGAGGTGTCCGGTGGGAGGAGAGCCAGCAGGCCCGTCTTATCGCTTCCCACAGGTCTTAAAATTATCGGTGGGGGGCGTTTGTCCAGAACTTAGAGGACCCGTCCGCCCCCCACCATGGGCAACGCGGCTACCGCGAAGAAGGGGGGCGAGATTGAAAGCGTGAAAGAATTTCTGGCCAAAGCAAAAGAAGATTTTCTGAAAAAATGGGAGAATCCAGCACAGAACACGGCTCACCTGGACCAGTTTGAGCGAATTAAAACCCTTGGCACTGGGTCGTTTGGGCGAGTAATGCTGGTCAGACAAAAAGAAAATGGCAGTCACTTTGCTATGAAGATCTTGGACAAGCAGAAGGTGGTGAAGTTGAAGCAGATTGAGCACACTTTGAATGAGAAACGGATCCTGCAGGCTGTGAATTTCCCATTCCTTGTGCGGCTGGAGTATTCATTTAAGGATAACAGCAATCTGTACATGGTCATGGAGTATGTAGCCGGCGGGGAGATGTTCTCTCATTTGCGCAGAATCGGGCGCTTCAGTGAACCTCACGCACGCTTCTATGCATCCCAGATTGTATTAACTTTTGAATATCTGCATGCCCTGGATCTTATATACAGAGACTTGAAGCCAGAGAATCTTCTCATAGACCAACAGGGAA
  5   1   2       bld Oo1  5g                         IMAGE:6643223.5p                                                                                            GTGGGAGGAGAGCCAGCAGGCCCGTCTTATCGCTTCCCACAGGTCTTAAAATTATCGGTGGGGGGCGTTTGTCCAGAACTTAGAGGACCCGTCCGCCCCCCACCATGGGCAACGCGGCTACCGCGAAGAAGGGGGGCGAGATTGAAAGCGTGAAAGAATTTCTGGCCAAAGCAAAAGAAGATTTTCTGAAAAAATGGGAGAATCCAGCACAGAACACGGCTCACCTGGACCAGTTTGAGCGAATTAAAACCCTTGGCACTGGGTCGTTTGGGCGAGTAATGCTGGTCAGACAAAAAGAAAATGGCAGTCACTTTGCTATGAAGATCTTGGACAAGCAGAAGGTGGTGAAGTTGAAGCAGATTGAGCACACTTTGAATGAGAAACGGATCCTGCAGGCTGTGAATTTCCCATTCCTTGTGCGGCTGGAGTATTCATTTAAGGATAACAGCAATCTGTATATGGTCATGGAGTATGTAGCCGGCGGGGAGATGTTCTCTCATTTGCGCAGAATCGGGCGCTTCAGTGAACCTCACGCACGCTTCTATGCATCCCAGATTGTATTAACTTTTGAATATCTGCATGCCCTGGATCTTATATACAGAGACTTGAAGCCAGAGAATCTTCTCATAGACCAACAGGGATACATCCAGGTGACAGATTTTGGCTTTGCAAAGAGAGTGAAAGGGAGGACCTGGACCCTGTGTGGGACCCCCGAGTACCTTGCACCAGAAATAATCCTTAGCAAGGGTTATAATAAAGCAATGGGGATTGGTGGGGCCCTAGGAGTCCTGATTTATGAGATGGCTGCGGGATATCCTCCATTTTTCGCTGATCAGCCCATTCAGATCTATGAAAATNANTAATTCCGGGGAAAGGTCCGGTTCCCCTCTCACTTCAGCTCCCGACT
  5   1   2      seed Egg3 5g                IMAGE:3377963-IMAGp.IMAGp                                                                                                                                   TCCCGGGGTAAATTATCGGTGGGGGGCGTTTGTCCAGAACTTAGAGGACCCGTCCGCCCCCCACCATGGGCAACGCGGCTACCGCGAAGAAGGGGGGCGAGATTGAAAGCGTGAAAGAATTTCTGGCCAAAGCAAAAGAAGATTTTCTGAAAAAATGGGAGAATCCAGCACAGAACACGGCTCACCTGGACCAGTTTGAGCGAATTAAAACCCTTGGCACTGGGTCGTTTGGGCGAGTAATGCTGGTCAGACAAAAAGAAAATGGCAGTCACTTTGCTATGAAGATCTTGGACAAGCAGAAGGTGGTGAAGTTGAAGCAGATTGAGCACACTTTGAATGAGAAACGGATCCTGCAGGCTGTGAATTTCCCATTCCTTGTGCGGCTGGAGTATTCATTTAAGGATAACAGCAATCTGTATATGGTCATGGAGTATGTAGCCGGCGGGGAGATGTTCTCTCATTTGCGCAGAATCGGGCGCTTCAGTGAACCTCACGCACGCTTCTATGCATCCCAGATTGTATTAACTTTTGAATATCTGCACGCCCTGGATCTTATATACAGAGACTTGAAGCCAGAGAATCTTCTCATAGACCAACAGGGATACATCCAGGTGACAGATTTTGGCTTTGCAAAGAGAGTGAAAGGGAGGACCTGGACCCTGTGTGGGACCCCCGAGTACCTTGCGCCAGAAATAATCCTTAGCAAGGGTTATAATAAGGCAGTGGATTGGTGGGCCCTAGGAGTCCTGATTTATGAGATGGCTGCGGGATATCCTCCATTTTTCGCTGATCAGCCCATTCAGATCTATGAAAAAATAGTATCAGGGAAGGTCCGGTTCCCCTCTCACTTCAGCTCCGACTTGAAGGGATCTTCTCAGAAACCTTTTGCAAGGTCGACCTGACTAAGCGATTTGGGAATTGAAGAACGGTGTCACAGACATCAAAGGGACACAAATGGTTCAGTACCACGGAC
  5   1   2       bld Egg3 5g3  out                   IMAGE:3377963.5p                                                                                                                                                                 TGTCCAGAACTTAGAGGACCCGTCCGCCCCCCACCATGGGCAACGCGGCTACCGCGAAGAAGGGGGGCGAGATTGAAAGCGTGAAAGAATTTCTGGCCAAAGCAAAAGAAGATTTTCTGAAAAAATGGGAGAATCCAGCACAGAACACGGCTCACCTGGACCAGTTTGAGCGAATTAAAACCCTTGGCACTGGGTCGTTTGGGCGAGTAATGCTGGTCAGACAAAAAGAAAATGGCAGTCACTTTGCTATGAAGATCTTGGACAAGCAGAAGGTGGTGAAGTTGAAGCAGATTGAGCACACTTTGAATGAGAAACGGATCCTGCAGGCTGTGAATTTCCCATTCCTTGTGCGGCTGGAGTATTCATTTAAGGATAACAGCAATCTGTATATGGTCATGGAGTATGTATCCGGCGGGGAGATGTTCTCTCATTTGCGCAGAATCGGGCGCTTCAGTGAACCTCACGCACGCTTCTATGCATCCCAGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)