Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:3377728-IMAGp.5                24 END     1          20        4                (no blast hit)
     2   1.0    0Xl3.1-XL040h22.3                            9 END     2          40       22                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-PBX0097F11.5                         14 PI      92          6      637                (no blast hit)

 This cluster: approximate FL confidence score = 66%

 1012780780 Xl3.1-XL040h22.5 - 5 ESTs
                                                                       ....-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL040h22.5                                                                                                                                                                                                                                                     TCCTCCTGCTGCTGCCGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCGCAGCCTTTGCTTCTCCGTGTGAGGCTTCTGTACAAGATGGCGGGATCCCTGGTTGAAAGTGAAGCGCTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTGACATCACCTGTACAAGCGGAGGTTTATTTCCCACGGCTGACTGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCAGGAAAGAAAATCCTTATTATGGGAATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGAGACTCGGAAGATCCAGCAGCTGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGTTCCTAAGGAATGCGTGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCCGCAATACCTTATTTCCCGTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCAATTCAGGATAATTGTGGACGGACATCAGCTCTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAATACAATTAAAATCAATGGTGACCTACAACTGACCAAACTTGGTTGACGATTGACTATGTTCCCACCCCAGCGGTGGACGAGTACAACCAACGCAAGGTCACAAGCAGCGCAGTTCATTGTGTCCTCAACACCAAGACCTTGTATTTACTCCTGCGAGTAACAGGCCGAGGGACAATAGTTACAGAGAGACGTTTTATTTGATTATTTTAATGGACAGTGTGGTACATTACAGGCGGGCTGCCACGTATATTACCAACAATTAGTCTTTATTTTTTGACCTGGACTACAATGAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTCTTTTTTAGCCTTTTTT
                                                  Xl3.1-CHK-1012704251                                                                                                                                                                                                                                                           TGCTGCTGCCGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCGCAGCCTTTGCTTCTCCGTGTGAGGCTTCTGTACAAGATGGCGGGATCCCTGGTTGAAAGTGAAGCGCTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTGACATCACCTGTACAAGCGGAGGTTTATTTCCCACGGCTGACTGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCAGGAAAGAAAATCCTTATTATGGGAATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGAGACTCGGAAGATCCAGCAGCTGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGTTCCTAAGGAATGCGTGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCCGCAATACCTTATTTCCCGTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCAATTCAGGATAATTGTGGACGGACATCAGCTCTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAATACAATTAAAATCAATGGTGACCTACAACTGACCAAACTTGGTTGACGATTGACTATGTTCCCACCCCAGCGGTGGACGAGTACAACCAACGCAAGGTCACAAGCAGCGCAGTTCATTGTGTCCTCAACACCAAGACCTTGTATTTACTCCTGCGAGTAACAGGCCGAGGGACAATAGTTACAGAGAGACGTTTTATTTGATTATTTTAATGGACAGTGTGGTACATTACAGGCGGGCTGCCACGTATATTACCAACAATTAGTCTTTATTTTTTGACCTGGACTACAATGAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTCTTTTTTAGCC
                                                      consensus depths                                                                                                                                                                                                                                                          3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      98     126                                                                                                                                                                                                                                                     
                                               BLH MIN      98      72                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ==== 2e-007     NP_611349.2 CG5335-PA [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ag ---- 2e-010     XP_318003.2 galectin (AGAP004806-PA) [Anopheles gambiae str. PEST] =====================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 7e-013     NP_001022189.1 gaLECtin family member (lec-2) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PREDICTED - Sp ---- 1e-017     XP_001191059.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 9e-051     NP_001038765.1 hypothetical protein LOC723995 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Cf ---- 3e-069     XP_538509.2 PREDICTED: similar to Galectin-5 (RL-18) [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Mm ==== 4e-071     NP_776113.1 RIKEN cDNA 1110067D22 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Bt ==== 3e-071     XP_594786.3 PREDICTED: similar to RIKEN cDNA 1110067D22 gene [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Hs ==== 2e-071     NP_054900.2 hypothetical protein LOC29094 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 2e-073     NP_001008456.1 similar to RIKEN cDNA 1110067D22 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 3e-093     CAJ83081.1 novel galactoside-binding lectin family protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Xl ==== 4e-095     NP_001090244.1 hypothetical protein LOC779149 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL040h22.5                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------ATG---------------------------------------------------------------------------------------------------TAA---------------TAG------------------------------------------------------------------------------------------------TGA------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2      seed Neu7 5g   out                        XL040h22.5p                                                                                                                                                                                                                           GGTGGAGTTGGACTCAGNACCTCCCCTCCTCCTGCTGCTGCCGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCGCAGCCTTTGCTTCTCCGTGTGAGGCTTCTGTACAAGATGGCGGGATCCCTGGTTGAAAGTGAAGCGCTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTGACATCACCTGTACAAGCGGAGGTTTATTTCCCACGGCTGACTGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCAGGAAAGAAAATCCTTATTATGGGAATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGAGACTCGGAAGATCCAGCAGCTGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGTTCCTAAGGAATGCGTGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCCGCAATACCTTATTTCCCATTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCAATTCAGGATAATTGTGGACGGACATCAGCTCTTTGACTTTTATCATTCGCGTCGAGAGCCTTTCAGCCATTAATACAATTAAAATCAATGGTGACCTACAACTGA
  5   1   2       bld Neu7 5g   out                        XL024p23.5p                                                                                                                                                                                                                             GTGGAGTTGGACTCAGACCTCCCCTCCTCCTGCTGCTGCCGACACCTCCTTCTCCCTCCCGGGCTCCAGCTGATCCGGTGCCCCCGCAGCCTTTGCTTCTCCGTGTGAGGCTTCTGTACAAGATGGCGGGATCCCTGGTTGAAAGTGAAGCGCTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTGACATCACCTGTACAAGCGGAGGTTTATTTCCCACGGCTGACTGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCAGGAAAGAAAATCCTTATTATGGGAATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGAGACTCGGAAGATCCAGCAGCTGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGTTCCTAAGGAATGCGTGTGTATCCGGAAAGTGGGGAGAAGAA
  5   1   2       bld Em10 5g                         IMAGE:8321619.5p                                                                                                                                                                                                                              TGGTGGAGTTGGActcagacctcccctcctcctgctgctgccgacacctcctcctccctcccGGGCTCCAGCTGATCCGGTGCCCCCGCAGCCTTTGCTTCTCCGTGTGAGGCTTCTGTACAAGATGGCGGGATCCCTGGTTGAAAGTGAAGCGCTGATGGGCGTTAGACGTTTGAGCAGTCCCTTGACATCACCTGTACAAGCGGAGGTTTATTTCCCACGGCTGACTGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCAGGAAAGAAAATCCTTATTATGGGAATTGTTAACCTGGAGCCAAAGAGTTTTGACATCCGGTTGACATGCGGAGACTCAGAAGATCCAGCAGCTGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGTTCCTAAGGAATGCATGTGTATCCGGAAAGTGGGGAGAAGAAAGAGTCCGCAATACCTTATTTCCCGTTCATAGCAGATCAGCCTTTTCAGAGTAGAGATACACTGCGAGCACTCCTCAATTCAGGATAATTGTGGACGGACATCAGCTCTTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTTAATACATTTAAAATTCAATGGGTGACCTACTACTG
  5   1   2       bld Eye1 5x3                        IMAGE:6958715.5p                                                                                                                                                                                                                                                                                                                                             TTCTGTACAGATGGCGAGATCCCTGGTTGAAAGTGAAGCGCTGCAGATGGGCGTTAGACGTTTGAGCAGTCCCTTGACATCACCTGTACAAGCGGAGGTTTATTTCCCACGGCTGACTGTTCCATTCTGTGGTCATATAAAAGGAGGCCTGAGACCAGGAAAGAAAATCCTTATTATGGGAATTGTTAACCTGGAGCCAAAGAGTTTTGACATCAGGTTGACATGCGGAGACTCGGAAGATCCAGCAGCTGATATTGCCATTGAGCTGAGAGCAGAGTTTGCTGACAAACAGTTCTTAAGGAATGCGTGTGTATCCGGAAAGTGGGGAGAAGAAGAGTCCGCAATACCTTATTTCCCGTTCATAGCAGATCAGCCTTTCAGAGTAGAGATACACTGTGAGCACCCTCAATTCAGGATAATTGTGGACGGACATCAGCTCTTTGACTTTTATCATCGCGTCGAGAGCCTTTCAGCCATTAATACAATTAAAATCAATGGTGACCTACAACTGACCAAACTTGGTTGACGATTGACTATGTTCCCACCCCAGCGGTGGACGAGTACAACCAACGCAAGGTCACAAGCAGCGCAGTTCATTGTGTCCTCAACACCAAGACCTTGTATTTACTCCTGCGAGTAACAGGCCGAGGGACAATAGTTACAGAGAGACGTTTTATTTGATTATTTTAATGGACAGTGTGGTACATTACAGGCGGGCTGCCACGTATATTACCAACAATTAGTCTTTATTTTTTGACCTGGACTACAATGAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTCttttttagcctttttttGTTTGTTCCGGATTAAATCTGCCACTGACACCATGCAACCCATGAATGAA
  5   1   1       add DMZ       out                        xl252o19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAACAATTAGTCTTTATTTTTTGACCTGGACTACAATGAACTGGAAACTGCAAGTCACATGACTTGTGCTTCTTcttttttagccttttttGTTTGTTCTGGATTAAATCTGCCACTGACACCATGCAGCCAATGAATGAAAGGGATTTTAATTGTCTGCCTTTCATTGATTTTACTATCAAAGGCattttcattttatttttgttttatttttttATAGCATGTAGCCAGTAAATCTATTTTTTGGCAAAGGTGAAAAAATGCTTTAATAGTATAATACCAGAAGGCCCTTACATTTTGCTCTTGGGACTAATGGGCTTGCAGTGTTGCaaaaaaaaaaNGGGNAANATATAANCATTTTTTTAACANGTANCAACATTCAGNCAAACATaaaaaaaaNCCAATTTATTNGNAAAANCATNGTTTTNGCNCTAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)