Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5536730.3                       7 END     1          14       14                (no blast hit)

 This cluster: approximate FL confidence score = 77%

 1012780978 Xl3.1-IMAGE:4681287-IMAGp.5 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4681287-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGCCTCTGCTTATATCCTACACTCTCTCTTTGTCAGCCACAAGTAAATTCAAACTGGTGCAAGAAGACCAGCAGGGAAACAGGGAAAGGAATCTCTTTCAGGAGGCTGAGTCTGGTGGGAATACAACTTGGCAATGGAGGACGAAGTGAAATGGGCGACCGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGCAAAGCCACGTTTTCGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAAAAATACCAGCCGCCTGTGAATCGAAATCTTGCCAATTTAAAGGGTGATGACCGCGTGAGGAAGACTTCAGTTGACCTGAGAAAAGAAATTATTGATGTTGGTGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCATTGACAGTTGCTCTCGAACCACCTCCTGAGCCAGAGCTTACAGGACCTGTCACTGCTGAGGCATTCCTCAAGGCTGCTGCTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTCAGGGATAGGCTGGATAGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGATGTAGTAAAGCTTCTTCAGGATAGTGGAGCAGAAATAAATGTCAA
                                                  Xl3.1-CHK-1012699374                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCTGCTTATATCCTACACTCTCTCTTTGTCAGCCACAAGTAAATTCAAACTGGTGCAAGAAGACCAGCAGGGAAACAGGGAAAGGAATCTCTTTCAGGAGGCTGAGTCTGGTGGGAATACAACTTGGCAATGGAGGACGAAGTGAAATGGGCGACCGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGCAAAGCCACGTTTTCGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAAAAATACCAGCCGCCTGTGAATCGAAATCTTGCCAATTTAAAGGGTGATGACCGCGTGAGGAAGACTTCAGTTGACCTGAGAAAAGAAATTATTGATGTTGGTGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCATTGACAGTTGCTCTCGAACCACCTCCTGAGCCAGAGCTTACAGGACCTGTCACTGCTGAGGCATTCCTCAAGGCTGCTGCTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTCAGGGATAGGCTGGATAGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGATGTAGTAAAGCTTCTTCAGGATAGTGGAGCAGAAATAAATGTCAAAGACAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     6     4     6     5     6     3     5     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C---------T-
                                               BLH ATG     136     149                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      76      71                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     136      45                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      -1      17                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     136       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 5e-007     NP_001071982.1 zinc finger protein [Ciona intestinalis] ------------------------------------------------------------------------------===========================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 5e-009     NP_725993.1 CG9025-PB, isoform B [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 3e-009     NP_001021269.1 UNCoordinated family member (unc-44) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- At ---- 2e-010     NP_001032135.1 calmodulin-binding protein [Arabidopsis thaliana] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Os ---- 6e-011     NP_001060523.1 Os07g0659100 [Oryza sativa (japonica cultivar-group)] ======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - ?? ---- 5e-012     XP_001787700.1 PREDICTED: similar to ankyrin 2 [Bos taurus] --------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 5e-013     XP_001193458.1 PREDICTED: similar to ankyrin 2,3/unc44 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Bt ---- 2e-035     NP_001029550.1 ankyrin repeat domain 1 (cardiac muscle) [Bos taurus] -----------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ==== 2e-051     XP_421709.2 PREDICTED: similar to skeletal muscle ankyrin repeat [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Dr ==== 3e-053     XP_691649.2 PREDICTED: similar to Ankyrin repeat domain-containing protein 2 (Skeletal muscle ankyrin repeat protein) (mArpp) [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ==== 3e-064     NP_064417.1 ankyrin repeat domain 2 (stretch responsive muscle) [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 6e-065     NP_001123453.1 ankyrin repeat domain 2 isoform b [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Cf ==== 2e-066     XP_850948.1 PREDICTED: similar to ankyrin repeat domain 2 [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Xt ==== 2e-108     NP_001090801.1 hypothetical protein LOC100037897 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 2e-115     NP_001080601.1 ankyrin repeat domain 2 (stretch responsive muscle) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4681287-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAA------------------------------------------------------------TGA------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2      seed Emb4 5g3  out                   IMAGE:5536730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCAGCCTCTGCTTATATCCTACACTCTCTCTTTGTCAGCCACAAGTAAATTCAAACTGGTGCAAGAAGACCAGCAGGGAAACAGGGAAAGGAATCTCTTTCAGGAGGCTGAGTCTGGTGGGAATACAACTTGGCAATGGAGGACGAAGTGAAATGGGCGACCGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGCAAAGCCACGTTTTCGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAAAAATACCAGCCGCCTGTGAATCGAAATCTTGCCAATTTAAAGGGTGATGACCGCGTGAGGAAGACTTCAGTTGACCTGAGAAAAGAAATTATTGATGTTGGTGGCATCCAAAATCTAATTgaaatacgaaaaaagagacaggagagaaaaaagaagaaGTCATTGACAGTTGCTCTCGAACCACCTCCTGAGCCAGAGCTTACAGGACCTGTCACTGCTGAGGCATTCCTCAAGGCTGCTGCTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGGGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTAAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAACTGGAAGTAGTGAAGCTTCTTCANGATA
  5   1   2       bld Emb4 5g                IMAGE:4681287-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGCCTCTGCTTATATCCTACACTCTCTCTTTGTCAGCCACAAGTAAATTCAAACTGGTGCAAGAAGACCAGCAGGGAAACAGGGAAAGGAATCTCTTTCAGGAGGCTGAGTCTGGTGGGAATACAACTTGGCAATGGAGGACGAAGTGAAATGGGCGACCGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGCAAAGCCACGTTTTCGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAAAAATACCAGCCGCCTGTGAATCGAAATCTTGCCAATTTAAAGGGTGATGACCGCGTGAGGAAGACTTCAGTTGACCTGAGAAAAGAAATTATTGATGTTGGTGGCATCCAAAATCTAATTgaaatacgaaaaaagagacaggagagaaaaaagaagaaGTCATTGACAGTTGCTCTCGAACCACCTCCTGAGCCAGAGCTTACAGGACCTGTCACTGCTGAGGCATTCCTCAAGGCTGCTGCTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGGGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTAAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAACTGGAAGTAGTGAAGCTTCTTCAGGATAGTGGAGCAGAGATAAATGTCAAAGACAAGCTCCTTAGCACACCTCTCCATGTTGCTACACGCACTGGGTCATGCTCA
  5   1   2       bld Emb4 5g                         IMAGE:4681287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGCCTCTGCTTATATCCTACACTCTCTCTTTGTCAGCCACAAGTAAATTCAAACTGGTGCAAGAAGACCAGCAGGGAAACAGGGAAAGGAATCTCTTTCAGGAGGCTGAGTCTGGTGGGAATACAACTTGGCAATGGAGGACGAAGTGAAATGGGCGACCGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGCAAAGCCACGTTTTCGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAAAAATACCAGCCGCCTGTGAATCGAAATCTTGCCAATTTAAAGGGTGATGACCGCGTGAGGAAGACTTCAGTTGACCTGAGAAAAGAAATTATTGATGTTGGTGGCATCCAAAATCTAATTgaaatacgaaaaaagagacaggagagaaaaaagaagaaGTCATTGACAGTTGCTCTCGAACCACCTCCTGAGCCAGAGCTTACAGGACCTGTCACTGCTGAGGCATTCCTCAAGGCTGCTGCTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGGGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTAAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAACTGGAAGTAGTGAAGCTTCTTCAGGATAGTGGAGCAGAAATAAATGTCAAAGACAAGCCTCCTTAGCACACCTCTCCATTGTTGCTACACCCCACTGGTCCATGCTCCATATTGGGGAAGCAACTTGATTGGCTACTGGGGGTGGGA
  5   1   2       bld Tbd7 5x3  out                        XL054h07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGCTTATATCCTACACTCTCTCTTTGTCAGCCACAAGTAAATTCAAACTGGTGCAAGAAGACCAGCAGGGAAACAGGGAAAGGAATCTCTTTCAGGAGGCTGAGTCTGGTGGGAATACAACTTGGCAATGGAGGACGAAGTGAAATGGGCGACCGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGCAAAGCCACGTTTTCGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAAAAATACCAGCCGCCTGTGAATCGAAATCTTGCCAATTTAAAGGGTGATGACCGCGTGAGGAAGACTTCAGTTGACCTGAGAAAAGAAATTATTGATGTTGGTGGCATCCaaaatctaattgaaatacgaaaaaagagacaggagagaaaaaagaagaagTCATTGACAGTTGCTCTCGAACCACCTCCTGAGCCAGAGCTTACAGGACCTGTCACTGCTGAGGCATTCCTCAAGGCTGCTGCTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGAGCATCATTGGAAGGTCACGTAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGG
  5   1   2       add Emb4                            IMAGE:5571938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCTCAACCACAAATAAACCCAATCTGGTGGCAGGAGACAAATCTCAGCTGAAAAACAGGGAAAGGGACCTCTTTCTGGAGTCTAGTGGGAATATTGAATACAACTTGGCAATGGAGGACGAAGTCAAATGGGCGACCGATATTATTGATCAGAAGCTGGAGCTGGAGGAACATGAGAAGGTAAAGCCTCGTTTTAGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAGAAATACCAGCCACCGGTGAATCGAAATCTCGCTAATTTAAAGGGTGATGACCGTGTGAGGAAGACTTCTGTTGACCTAAGAAAAGAAATTATCGATGTCGGTAGCATCcaaaatctaattgaaatacgaaaaaagagacaggagagaaaaaagaagaaGTCATTGATAGTTGCTCCTGAACCACCTCCGGAGCCAGAGCTTACAGGACCTGTCACTGCCGAGGCATTCCTCAAGGCTGCTGTTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAAGAGAACAGCACTTCACAGAGCATCATTGGAGGGTCACATAGAAATCATNCAGAAACTTTTAGACAGTGGATCATCGGTCAACTTCAGGGATAGGCTGGATAGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGATGTANTAAAGCTTCTTCAGGATTAATGGAGCCGAAAATAAATGTCCAAGACAAGCTACTAAGTACACCCTCTCCATGGTGCCCACACGCACTGGCCATGCCTCCATATTGTGGAGACCCCTGATTGCCTACCTGGTGTAAAAAACCAATGGCCAGGGAAATAGGGGAAAAGGGACACCCTGGCTCCTTCCCGTGAATTCCGGGCCAGAAATTAAATTCCGCCTTCCAAGGAATCCCTCTCAAAAGGGCCTTAC
  5   1   2       add Bone                            IMAGE:8742474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTCTTTATGGCAGATCGCATCGATTCATATTCGTCCGACGAAGTCAAATGGGCGACCGATATTATTGATCAGAAGCTGGAGCTGGAGGAACATGAGAAGGTAAAGCCTCGTTTTAGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAGAAATACCAGCCACCGGTGAATCGAAATCTCGCTAATTTAAAGGGTGATGACCGTGTGAGGAAGACTTCTGTTGACCTAAGAAAAGAAATTATCGATGTCGGTAGCATCCaaaatctaattgaaatacgaaaaaagagacaggagagaaaaaagaagaagTCATTGATAGTTGCTCCTGAACCACCTCCGGAGCCAGAGCTTACAGGACCTGTCACTGCCGAGGCATTCCTCAAGGCTGCTGTTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAAGAGAACAGCACTTCACAGAGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTCAGGGATAGGCTGGATAGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGATGTAGTAAAGCTTCTTCAGATAGTGGAGCAGAAATAAATGTCAAAGACAAGCTACTAAGTACACCTCTCCATGTGGCCACACGCACTGGTCATGCTCATATTGTGGAGCACCTGATTGCTACTGGTGTAGAAATCAATGGCAGGATAGGGAAGTGACACTGCTCTTCATGATCTGTCAGACTATCGCTACAGATCATCAAATGCTTATTTTTATACGGAGCATATGATGCAAGATTGCGACGGCAACTCCTCGGACCTGTGCAGCATGCCAGCCGAACCAAAGAAAATGTTTGGGCAAAGTTCAACACCGGTTCAC
  5   1   2       add Emb4                            IMAGE:4970141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTGGAGGATGGTTGCTCTCCAGACACTTGTGATGAGTTCAAGAGAACAGCACTTCACAGAGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTCAGGGATAGGCTGGATAGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGATGTAGTAAAGCTTCTTCAGGATAGTGGAGCAGAAATAAATGTCAAAGACAAGCTACTTAGTACACCTCTCCATGTGGCCACACGCACTGGTCATGCTCATATTGTGGAGCACCTGATTGCTACTGGTGTAGAAATTAATGGCAGGGATAGGGAAGGTGACACTGCTCTTCATGATTCTGTCAGACTTAATCGGTACAAGATCATCAAAATGCTTATTTTATACGGAGCCAATATGATGGCAAAGAATGCAGACGGCAAAACTCCCACAGACCTTGTGCAGCAATGGCAGGCAGACACCAAAGAGATGCTGGTGAAAAAGTCAAACACCGTTTCAGAGAAGCAAGTGTGATGCAGAGAGAGGCGACACTTCACCATTCGACTAGATACCTGCATGTCATTTTGAGGGTGTGTTTGGCCAATGCTGCCAAAAAGGATATATATTTTTAATGCATTTTGATTTAATTTAAGACATTTCTGTACAGCAAGCCCTTTCCTTGTGTAATATATTGTAAAATGTGCTTTATTTGTCTTTTACCTGTATATAATAACCAGAATGTGCCAGCTATGCTAANGCTGTGCTGAACACTTCATCACATAATGCAGCAATCCTTCATGACAGCAGTAGGTGGCATAACN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)