Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 06 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6957185.3                       7 END     1          16       14                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:6938609.5                       5 END     2          33       40                Excitatory amino acid transporter 1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012781113 Xl3.1-IMAGE:6957889.5 - 6 ESTs
                                                                       ....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6957889.5                         TGTTCACTGTCCTCTGTCTGCTTCTGCTGCTCAACGCTCCACATCCAACATCTCCTGTTTCTGGACAAAGCCTACTCCCTTTCATCATCCCACTGGAAGTTTTAGCAACAAGAGGCATTTAAAGGGGGAAAACAAGAAGATGACCAAAAGCAACGGGGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCAAAAAAAAGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTTCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGAATGTCTGCTCTCGACAGTAAGGCATCGGGAAAGATGGGAATACGAGCCGTGGTATATTACATGACAACAACGGTGCTTGCTGTTTTCATCGGTATTATTATTGTCATAATAATCCACCCAGGAAAGGGCAGCAAGGAGAAAATGCACAGAGAAGGAAAAATTGAGCAAGTAACTGCAGCTGATGCTTTTCTGGATTTAATAAGAAATATGTTCCCGCCTAACATGGTAGAAGCCTGCTTTAAACAGTTCAAGACAAACTATGAGAAGAAACTGTTTCGAGTCCCCATTCCAGCCAATGAATCCCTTCTGTCTTCAGTAGCCAATAATGTATCCGAGGCCATGGAAACATTGGTTAAGATGAGGGAAGAGATGATACCCGTTCCAGGAGCAGTGAATGGAGTCAATGCCCTTGGACTTGTGGTTTTCTCAATGTCCTTTGGGCTGGTCATTGGAAACATGAAAGAACAGGGGAAAGC
                                                  Xl3.1-CHK-1012701184                               CTGTCCTCTGTCTGCTTCTGCTGCTCAACGCTCCACATCCAACATCTCCTGTTTCTGGACAAAGCCTACTCCCTTTCATCATCCCACTGGAAGTTTTAGCAACAAGAGGCATTTAAAGGGGGAAAACAAGAAGATGACCAAAAGCAACGGGGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCAAAAAAAAGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTTCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGAATGTCTGCTCTCGACAGTAAGGCATCGGGAAAGATGGGAATACGAGCCGTGGTATATTACATGACAACAACGGTGCTTGCTGTTTTCATCGGTATTATTATTGTCATAATAATCCACCCAGGAAAGGGCAGCAAGGAGAAAATGCACAGAGAAGGAAAAATTGAGCAAGTAACTGCAGCTGATGCTTTTCTGGATTTAATAAGAAATATGTTCCCGCCTAACATGGTAGAAGCCTGCTTTAAACAGTTCAAGACAAACTATGAGAAGAAACTGTTTCGAGTCCCCATTCCAGCCAATGAATCCCTTCTGTCTTCAGTAGCCAATAATGTATCCGAGGCCATGGAAACATTGGTTAAGATGAGGGAAGAGATGATACCCGTTCCAGGAGCAGTGAATGGAGTCAATGCCCTTGGACTTGTGGTTTTCTCAATGTCCTTTGGGCTGGTCATTGGAAACATGAAAGAACAGGGGAAAGCTTTGAA
                                                      consensus depths                              2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG     139     738                         
                                               BLH MIN     139     123                         
                                               BLH MPR     136     123                         
                                               BLH OVR     139     248                         
                                               CDS MIN     139     123                         
                                               ORF LNG     139      11                         
  5   1   2       bld Emb4 5g                         IMAGE:4970540.5p cggacgcgtgggcggacgcgtgggTGTTCACTGTCCTCTGTCTGCTTCTGCTGCTCAACGCTCCACATCCAACATCTCCTGTTTCTGGACAAAGCCTACTCCCTTTCATCATCCCACTGGAAGTTTTAGCAACAAGAGGCATTTAAAGGGGGAAAACAAGAAGATGACCAAAAGCAACGGGGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCaaaaaaaaGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTN
  5   1   2       bld Emb4 5g3  out                   IMAGE:4959080.5p                         TGTTCACTGTCCTCTGTCTGCTTCTGCTGCTCAACGCTCCACATCCAACATCTCCTGTTTCTGGACAAAGCCTACTCCCTTTCATCATCCCACTGGAAGTTTTAGCAACAAGAGGCATTTAAACGGGGAAAACAAGAAGATGACCAAAAGCAACGGGGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCaaaaaaaaGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTTCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGCATGTCTGCTCTCGACAGTAAGGCATCGGGAAAGATGGGAATACGAGCCGTGGTATATTACATGACAACAACTGTGCTTGCTGTATTTATCGGTATTATTATTGTCATAATAAT
  5   1   2       bld Eye1 5g3  out                   IMAGE:6957724.5p                                                    TCGGAATGTCTGGATAAAGTTCTTGCTACTCCGCCTAGTCCCTTTCATCATCCATTGGAAGTTTTAGCAGCAATTTAATCCCAACAAGAGGCATTTAAAGGGGAAGAAGAAGATGACTAAAAGCAACGGGGAAGATCCACGTTCAGGGAACAGGATGGAACGCTTCCAGGAAGGGGTTCGCCAGCGTTCACTGATGGCCaaaaaaaaGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGGAATGGCTTTGTTCTTTTTACTGTCTTCGCTGTCATTATTGGAATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTGCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGAATGGCTGCTCTTGACAGTAAGGCATCAGGAAAGATGGGTATAAGAGCCGTGGTATATTACATGACGACAACGGTGATTGCGGTGTTCATCGGTATCATTATTGTCATAATAATCCACCCGGGAAAGGGCAGCAAGGATAAAATGCACCGAGAAGGAAAAATTGAGCGAGTAACCGCGGCTGATGCTTTTCTGGATTTAATAAGAAATATGTTTCCTCCTAACATGGTAGAAGCCTGCCTTTAACAGTTCCAGAACAAACTATGGAGAAGAAAACTGGTTTCTAGCTCCCTGGTTTCCACACCAATGGAGTCACCTGCCTATCCATTCAATTAGCCCCAATAAATGGGTATCCTGGAAAGCCCCTGGGGAAATCATTTGGGGTCCCAAGAATGGAGGCGGGAGGGGAAAATTGAATTACCCCCCATTCCCCCAGGGGAAGCCAACGTTGGAAAAGGGGGAGAGTTACCAATGGTCCCCCCTTTGTGGGGACTATCGGTGGG
  5   1   2      seed Eye1 5g                         IMAGE:6957889.5p                                                                                                                            TTTTAGCAACAAGAGGCATTTAAAGGGGGAAAACAAGAAGATGACCAAAAGCAACGGGGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCaaaaaaaaGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTTCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGAATGTCTGCTCTCGACAGTAAGGCATCGGGAAAGATGGGAATACGAGCCGTGGTATATTACATGACAACAACGGTGCTTGCTGTTTTCATCGGTATTATTATTGTCATAATAATCCACCCAGGAAAGGGCAGCAAGGAGAAAATGCACAGAGAAGGAAAAATTGAGCAAGTAACTGCAGCTGATGCTTTTCTGGATTTAATAAGAAATATGTTCCCGCCTAACATGGTAGAAGCCTGCTTTAAACAGTTCAAGACAAACTATGAGAAGAAACTGTTTCGAGTCCCCATTCCAGCCAATGAATCCCTTCTGTCTTCAGTAGCCAATAATGTATCCGAGGCCATGGAAACATTGGTTAAGATGAGGGAAGAGATGATACCCGTTCCAGGAGCAGTGAATGGAGTCAATGCCCTTGGACTTGTGGTTTTCTCAATGTCCTTTGGGCTGGTCATTGGAAACATGAAAGAACAGGGGAAAGCTTTGAANGACTTTTTTGACTCCCCTCATGAAGCAATTATGAAGATTGGTT
  5   1   2       bld Emb4 5g                IMAGE:4202450-IMAGp.IMAGp                                                                                                                                                          AAACAAGAAGATGACCAAAAGCAACGGGGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCaaaaaaaaGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTTCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGAATGTCTGCTCTCGACAGTAAGGCATCGGGAAAGATGGGAATACGAGCCGTGGTATATTACATGACAACAACGGTGCTTGCTGTTTTCATCGGTATTATTATTGTCATAATAATCCACCCAGGAAAGGGCAGCAAGGAGAAAATGCACAGAGAAGGAAAAATTGAGCAAGTAACTGCAGCTGATGCTTTTCTGGATTTAATAAGAAATATGTTCCCGCCTAACATGGTAGAAGCCTGCTTTAAACAGTTCAAGACAAACTATGAGAAGAAACTGTTTCGAGTCCCCATTCCAGCCAATGAATCCCTTCTGTCTTCAGTAGCCAATAATGTATCCGAGGCCATGGAAACATTGGTTAAGATGAGGGAAGAGATGATACCCGTTCCAGGAGCAGTGAATGGAGTCAATGCCCTTGGACTTGTGGTTTTCTCAATGTCCTTTGGGCTGGTCATTGGAAACATGAAAGAACAGGGGAAAGCTTTGAAGGACTTTTTTGACTCCCTCAATGAAGCAATTATGAGATTGGTTGCTGTAATCATGTGGTACGCACCAATTGGTATCCTCTTTCTGATTGCTGGAAAGATTGCCGAGATGGAAGATATGGGGGT
  5   1   2       bld Emb4 5g3  out                   IMAGE:4202450.5p                                                                                                                                                            CAAGAAGATGACCAAAAGCAACGGGNGAAGATCCACGGTCAGGGAACAGGATGGAGCGCTTCCAGGAAGGGGTTCGCCAGCGTTCTCTGATGGCCaaaaaaaaGATGCAGAACATAACAAAAGATGATGTGAAGAGTTTCTTCAAGCGCAATGGCTTTGTCCTTTTTACCGTCTTCGCTGTCATTATTGGTATCATCCTGGGATTTTCTGTCCGAAAGTATCACATGACGTTCAGAGAGATCAAGTACTTCTCCTTCCCAGGGGAGCTTCTCATGAGAATGCTGCAGATGCTGGTCCTCCCTCTGATTGTATCCAGCTTAGTGACAGGAATGTCTGCTCTCGACAGTAAGGCATCGGGAAAGATGGGAATACGAGCCGTGGTATATTACATGACAACAACGGTGCTTGCTGTTTTCATCGGTATTATTATTGTCATAATAATCCACCCAGGAAAGGGCAGCAAGGAGAAAATGCACAGAGAAGGAAAAATTGAGCAAGTAACTGCAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)