Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl270a18.5                            6 PI      86        261      588                bone morphogenetic protein 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 94%

 1012781128 Xl3.1-Ooc1-db24e07.5 - 10 ESTs
                                                                       ......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xl3.1-Ooc1-db24e07.5                                                                                                                                                                                 GCGAGAGAGCGAGGAACCAGCGCACCGGCCGTGGATCAGCTGCTGCCTGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGCGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGCGCACAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGGCTGCACCGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACGGAATCGGGTCGCTCGTCTCCCCAGCAGTCCCAGAGGGTCCTCAACCAGTTCGAGCTCCGGCTGCTCAGTATGTTTGGCTTGAAGAGGCGTCCGACGCCTGGCAAAAATGTTGTGATCCCACCCTACATGCTCTTGTACCACCT------------GTTGGCTGCTGA------------------------CCAGATGGAGCGGCGGGCAGCCAGCCGAGCAAATACAGTGAGGAGTTTCCACCATGAAGAATCCATGGAAGAAATTCCTGAGTCTCGTGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAATTCCAAATGAGGAGCTGGTCACTTCTGCCGAGCTGCGGATTTTTCGAGAGCAGGTCCAAGAGCCCTTTGAAAGTGACAGCAGCAAATTGCATCGGATTAATATTTACGACATTGTCAAGCCAGCGGCGGCTGCCTCCCGGGGCCCTGTTGTGAGACTATTGGACACCAGACTGGTACATCATAATGAAAGCAAATGGGAAAGTTTTGATGTAACGCCCGCAATTGCGCGGTGGATTGCACATAAACAGCCTAACCATGGGTTTGTTGTTGAAGTGACTCA
                                                  Xl3.1-CHK-1012695866                                                                                                                                                                                       GAGCGAGGAACCAGCGCACCGGCCGTGGATCAGCTGCTGCCTGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGCGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGCGCACAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGGCTGCACCGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACGGAATCGGGTCGCTCGTCTCCCCAGCAGTCCCAGAGGGTCCTCAACCAGTTCGAGCTCCGGCTGCTCAGTATGTTTGGCTTGAAGAGGCGxxxxxCxxxxxxCAAAAATGTTGTGATCCCACCCTAxxTGxxCTTGTACCACCTGCACTT------------TGCTGATGAAGGCACTTCTGCCAT------------GxxGxxGCGGGCAGCCAGCCGAGCAAATACAGTGAGGAGTTTCCACCATGAAGAATCCATGGAAGAAATTCCTGAGTCTCGTGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAATTCCAAATGAGGAGCTGGTCACTTCTGCCGAGCTGCGGATTTTTCGAGAGCAGGTCCAAGAGCCCTTTGAAAGTGACAGCAGCAAATTGCATCGGATTAATATTTACGACATTGTCAAGCCAGCGGCGGCTGCCTCCCGGGGCCCTGTTGTGAGACTATTGGACACCAGACTGGTACATCATAATGAAAGCAAATGGGAAAGTTTTGATGTAACGCCGGCAATTGCGCGGTGGATTGCACATAAACAGCCTAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGA
                                                      consensus depths                                                                                                                                                                                      2     2     5     5     5     6     5     7     5     7     5     7     5     7     6     8     6     8     6     8     7     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     7     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     4     8     4     8     4     8     3     7     2     6     2     6     2     6     2     6     2     5     0     5     2     5     0     5     0     5     2     5     1     4     1     4     1     4     1     3     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     343     328                                                                                                                                                                                 
                                               BLH MIN     343      82                                                                                                                                                                                 
                                               BLH OVR     343    1247                                                                                                                                                                                 
                                               EST CLI       3       6                                                                                                                                                                                 
                                                                       PROTEIN --- Dm ---- 8e-017     NP_722813.1 decapentaplegic CG9885-PE [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ag ==== 3e-021     XP_317480.2 AGAP007987-PA [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sp ---- 3e-028     NP_001116977.1 bone morphogenetic protein BMP2/4 [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 2e-034     NP_001071663.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 1e-061     NP_571435.1 bone morphogenetic protein 2b [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 5e-069     NP_031579.2 bone morphogenetic protein 2 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bt ==== 1e-070     NP_001092611.1 bone morphogenetic protein 2 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 3e-072     NP_001191.1 bone morphogenetic protein 2 precursor [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 8e-073     XP_534351.2 PREDICTED: similar to Bone morphogenetic protein 2 precursor (BMP-2) (BMP-2A) isoform 1 [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 7e-079     NP_989689.1 bone morphogenetic protein 2 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 6e-113     CAJ81649.1 bone morphogenetic protein 2 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 5e-118     NP_001079353.1 bone morphogenetic protein 2 A [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xl3.1-Ooc1-db24e07.5                                                                                                                                                                                                                                                                               ATG---------------------------------TGA------------------------TGA---------------------------ATG---------------------------------------------------------------------------------TGA---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                            ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       bld Ooc1 5g                          Ooc1-db24e07.y1                                                                                                                                                   GGGTCGACCCACGCGTCCGGTGgagagagagcgagagagcgagGAACCAGCGCACCGGCCGTGGATCAGCTGCTGCCTGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGTGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGCGCACAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGGCTGCACCGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACGGAATCGGGTCGCTCGTCTCCCCAGCAGTCCCAGAGGGTCCTCAACCAGTTCGAGCTCCGGCTGCTCAGTATGTNTGGCTTGAAGAGGCGTCCGACGCCTGGCAAAAATGTTGTGATCCCACCCTACATGCTG
  5   1   2       bld Emb1                            IMAGE:6636515.5p                                                                                                                                                                     CGGTGCCAGAGAGCGAGAGAGCGAGGAACCAGCGCACCGGCCGTGGATCAGCTGCTGCCCGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGCGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGTGCACAGGTACCGACTCCCTGCGACACAGTCGCTCCCCTGTCTCCTCCCATAGACACCTGGATGCTCAATAAGCTGCAGTTGGGCATCTCCTGGGGAAGTTCCCCTGCGACTGTAGTGCAGTCATTGCGCTTCCTCTTCCCTCAGCTTCTGCTTCTTCTCCACCTGCGCTCGGATTTGCTGTTGGGGGCAGTGACTGGGGCTCCTCCTGCGCCGCGACCCCCACACCTGCCCCGTGCGTCCCCCGCTCACCGCAATGGCTCCTGCGAATCATGTGCTACCTCGTTGCCCGTAcccccccccctcgcgccttcccctcccccggctgccccactcactccgcatccacccggccccccAATTCAGGCCTTCTTTCCCCAATAACTACGGGGCCCCTTGGGGGCACTGGAACCTCGTACCTTCGCGCCCTCAAGGGGCCCCGGCGTTGTCCACGGCCGCTGGGGTGCCACCCAGGgtgcccgccgcgcctgccctgtgccccgcccccccgcaattggcgcgaccccccccccccccccGGGGGGGTTCTTCTCTCCCAGGGGCGGGGAATCTCCTATATAGTAAACAAACCGCGCGGCACCCCCGCGGGCGTCACGGCCTGGGCTGGGCCN
  5   1   2       bld Emb4 5g                         IMAGE:4203050.5p                                                                                                                                                                                    GAGAGACGAGGAACCAGCGCACCGGCCGTGGATCAGCTGCTGCCTGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGCGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGCGCACAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGGCTGCACCGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACTTCATCGGGTCGCTCGTCTTCACACCAGTCCCAGAGG
  5   1   2       bld Neu5 5g                          Neu5-126I18A.5p                                                                                                                                                                                       GAGCGAGGAACCAGCGCACCGGCCGTGGATCAGCTGCTGCCTGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACGCGGTCGTCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGCGCACAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGGCTGCACCGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACGGAATCGGGTCGCTCGTCTCCCCAGCAGTCCCAGAGGGTCCTCAACCAGTTCGAGCTCCGGCTGCTCAGTATGTTTGGCTTGAAGAGGCGTCCC
  5   1   2      seed Egg1 5g                            PBX0130C04.5p                                                                                                                                                                                           GAGGAACCAGCGCACCGGCCGTGGATCAGCTGCTGCCTGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGCGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGCGCACAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGGCTGCACCGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACGGAATCGGGTCGCTCGTCTCCCCAGCAGTCCCAGAGGGTCCTCAACCAGTTCGAGCTCCGGCTGCTCAGTATGTTTGGCTTGA
  5   1   2       bld Ga18 5x                           xlk122o10ex.5p                                                                                                                                                                                                  CCAGCGCACCGNNCGTGGATCAGCTGCTGNCTGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGCGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGNNNNAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGGNTGCACCGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACGGAATCGGGTCGCTCGTCTCCCCAGCAGTCCCAGAGGNCCTCAACCAGTTCGAGCTCCGGCTGCTCAGTATGTTTGGCTTGAAGAGGCGNCCGACGCTGGCAAAAATGTTGTGATCCCACCCTACATGCTGGACTTGTACCACCTGCACTTGGNTCAGTTGGCTGCTGATGAAGNNACTTCTGCCATGGNNTTCCAGATGGAGNGG
  5   1   2       bld Ga18 5x                           xlk113i04ex.5p                                                                                                                                                                                                           CGNNCGTGGATCAGCTGCTGNCTGACCTGCCTCTTGCGCTCCGGATCCAGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCANNNNCCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGCGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCNNNNNNAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGNCTGCACTGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACGGAATCGGGTCGCTCGTCTCCCCAGCAGTCCCAGAGGNCCTCAACCAGTTCGAGCTCCGGCTGCTCAGTATGTTTGGNTTGAAGAGGCGTCCGACGCTGGCAAAAATGTTGTGATCCCACCCTACATGCTGGACTTGTACCACCTGCACTTGNNTCAGTTGGCTGCTGATGAAGGCACTTCTGCCATGGACTTCCAGATGGAGCGGGCAGNNAGCCGAGCAAATACAGNNAGGAGNTTCCACCATGAAGAATCCATGGNA
  5   1   2       bld Emb1                   IMAGE:6636515-IMAGp.IMAGp                                                                                                                                                                                                                                                          AGAGACAATTCTCCTGCGCTAATGTCCGCGCCTTCACGTCCGCACGGGACCTCGCACTGACATCCCAGGAGAGCGGCTCGTTGCTGACGGACACGGCGATCAGTCGCAGCGACTATGAGCAGAAAGCGAAGGACTGGGCTGCGAGCAGACGCACAGACTCGCCCTGGGAAGGAGACGCGTGGAGTAAAAAGACTCGAGTGATGTGGGAAAAACACACGGACAGCAGAAAACCATCATCGAGACACAAAGTCGGCGGCGCACAGGTACCGACTCCCTGCGACACAGTCGCTCCCCTGTCTCCTCCCATAGACACCTGGATGCTCAATAAGCTGCAGTTGGGCATCTCCTGGGGAAGTTCCCTGCGACTGTAGTGCAGTCATTGCGCTTCTCTTCCCTCAGCTTCTGCTTCTTCTCCACCTGCGCTCGGATTTGCTGTTGGGGCAGTGACTGGGGCTCCTCGTGCGCCGCGACCCCCACACCTGCCCCGTGCGTCCCCCGCTCACCGCAACGGCTCCTGCGACTCATGTGCTACCTTGTTGCCAGTAcccccccccATCGCGCATTCACATCACCCGCTGCCCCACTCACTCCGATCCACCTGCCCCTCATTTAGGCTTCTTTC
  5   1   2       bld Int2 5g                         IMAGE:8823074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAAAACCATCATCGAGACACAAAGTCGGCGGCGCACAGGTTGACAATGGTCGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGGTCTTGCTGAGTGGCTGCACCGGACTGATACCCGAGGAAGGCAAGCGCAAGTATACGGAATCGGGTCGCTCGTCTCCCCAGCAGTCCCAGAGGGTCCTCAACCAGTTCGAGCTCCGGCTGCTCAGTATGTTTGGCTTGAAGAGGCGTCCGACGCCTGGCAAAAATGTTGTGATCCCACCCTACATGCTGGACTTGTACCACCTGCACTTGGCTCAGTTGGCTGCTGATGAAGGCACTTCTGCCATGGACTTCCAGATGGAGCGGGCAGCCAGCCGAGCAAATACAGTGAGGAGTTTCCACCATGAAGAATCCATGGAAGAAATTCCTGAGTCTCGTGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAATTCCAAATGAGGAGCTGGTCACTTCTGCCGAGCTGCGGATTTTTCGAGAGCAGGTCCAAGAGCCCTTTGAAAGTGACAGCAGCAAATTGCATCGGATTAATATTTACGACATTGTCAAGCCAGCGGCGGCTGCCTCCCGGGGCCCTGTTGTGAGACTATTGGACACCAGACTGGTACATCATAATGAAAGCAAATGGGAAAGTTTTGATGTAACGCCCGCAATTGCGCGGTGGATTGCACATAAACAGCCTAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACATGACAAAATGTGCCTAGAGCATGTGAGATTAGTAGGTTCTTTACCCCGGATAAGATACTGGCCTCAGAATACGCATTGTGGTACTTTAGCATGATGTAAAGGACATGCTCTCAAAAGACAAGCGCAGCTAGCCAACACGTTAACGCCTTAATCGAACT
  5   1   0       add Emb4                            IMAGE:5516289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGAAATTCCTTCATTTTCAGTGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAATTCCAAATGAGGAGCTGGTCACTTCTGCCGAGCTGCGGATTTTTCGAGAGCAGGTCCAAGAGCCCTTTGAAAGTGACAGCAGCAAATTGCATCGGATTAATATTTACGACATTGTCAAGCCAGCGGCGGCTGCCTCCCGGGGCCCTGTTGTGAGACTATTGGACACCAGACTGGTACATCATAATGAAAGCAAATGGGAAAGTTTTGATGTAACGCCGGCAATTGCGCGGTGGATTGCACATAAACAGCCTAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCTAAGAAGCATGTGAGGATTAGTAGGTCTTTAACCCCGGATAAAGATAACTGGCCTCAGATACGGCCATTGTTGGTAACTTTTAGCCATGATGGTAAAGGACATGCTCTTCACAAAAGACAAAAGCGCCAAGCTAGGCACAAACAACGTAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTACGTAGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCTGGGTATCATGCCTTTTACTGCCACGGGGAATGTCCTTTTCCACTGGCAGACCATTTAAACTCTACAAACCATGCAATCGTACAAACTTTGGTGAACTCTGTCAACACAAACATCCCCAAGCTTGCTGCGTCCCACGAACTCAGTGCCATATCCTGCTCTATCTTGATGAGATGAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)