Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 06 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl270a18.5                            6 PI      86        261      588                bone morphogenetic protein 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 94%

 1012781128 Xl3.1-Ooc1-db24e07.5 - 10 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                      2     2     5     5     5     6     5     7     5     7     5     7     5     7     6     8     6     8     6     8     7     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     7     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     4     8     4     8     4     8     3     7     2     6     2     6     2     6     2     6     2     5     0     5     2     5     0     5     0     5     2     5     1     4     1     4     1     4     1     3     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     343     328                                                                                                                                                                                 
                                               BLH MIN     343      82                                                                                                                                                                                 
                                               BLH OVR     343    1247                                                                                                                                                                                 
                                               EST CLI       3       6                                                                                                                                                                                 
                                                                       PROTEIN --- Dm ---- 8e-017     NP_722813.1 decapentaplegic CG9885-PE [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ag ==== 3e-021     XP_317480.2 AGAP007987-PA [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sp ---- 3e-028     NP_001116977.1 bone morphogenetic protein BMP2/4 [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 2e-034     NP_001071663.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 1e-061     NP_571435.1 bone morphogenetic protein 2b [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 5e-069     NP_031579.2 bone morphogenetic protein 2 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bt ==== 1e-070     NP_001092611.1 bone morphogenetic protein 2 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 3e-072     NP_001191.1 bone morphogenetic protein 2 precursor [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 8e-073     XP_534351.2 PREDICTED: similar to Bone morphogenetic protein 2 precursor (BMP-2) (BMP-2A) isoform 1 [Canis familiaris] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 7e-079     NP_989689.1 bone morphogenetic protein 2 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 6e-113     CAJ81649.1 bone morphogenetic protein 2 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 5e-118     NP_001079353.1 bone morphogenetic protein 2 A [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xl3.1-Ooc1-db24e07.5                                                                                                                                                                                                                                                                               ATG---------------------------------TGA------------------------TGA---------------------------ATG---------------------------------------------------------------------------------TGA---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                            ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                ...
  5   1   0       add Emb4                            IMAGE:5516289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGAAATTCCTTCATTTTCAGTGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAATTCCAAATGAGGAGCTGGTCACTTCTGCCGAGCTGCGGATTTTTCGAGAGCAGGTCCAAGAGCCCTTTGAAAGTGACAGCAGCAAATTGCATCGGATTAATATTTACGACATTGTCAAGCCAGCGGCGGCTGCCTCCCGGGGCCCTGTTGTGAGACTATTGGACACCAGACTGGTACATCATAATGAAAGCAAATGGGAAAGTTTTGATGTAACGCCGGCAATTGCGCGGTGGATTGCACATAAACAGCCTAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCTAAGAAGCATGTGAGGATTAGTAGGTCTTTAACCCCGGATAAAGATAACTGGCCTCAGATACGGCCATTGTTGGTAACTTTTAGCCATGATGGTAAAGGACATGCTCTTCACAAAAGACAAAAGCGCCAAGCTAGGCACAAACAACGTAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTACGTAGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCTGGGTATCATGCCTTTTACTGCCACGGGGAATGTCCTTTTCCACTGGCAGACCATTTAAACTCTACAAACCATGCAATCGTACAAACTTTGGTGAACTCTGTCAACACAAACATCCCCAAGCTTGCTGCGTCCCACGAACTCAGTGCCATATCCTGCTCTATCTTGATGAGATGAAAAA

In case of problems mail me! (