Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk137h04ex.3                        14 END     4          50       28                similar to delta-like 1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012781155 Xl3.1-IMAGE:7980540.5 - 8 ESTs
                                                                       ...0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7980540.5    ACAGCTCCGAGCTGACACAAAGGAGGAAGCTCTGCAACCAAAGACAGCCTCCGGAACCAAATAGCCAATTCTTTATCTCTGCCTTAAACTCTTTTGATCCAAATTCAATTTGCAACCAAAGATCCAACTTTTCAACCAAAATTCTCGCCCACCTCTACCCGCTTTAGACACACCAAGGACTATCTGATCGATTGCAGCATCCACAGCCAGCTCTGTCCAGTGCCACCGGCTACTTCGTTTGGTGCCATTCTAACTGGGCTCTGTGCAACAACATTGCTACTCCGGACATGCGAATGGTCTCAGCCTCATAGCGATCCCACCCCATCACTCTCTCCTGCCTTTCTGGAACTCCCGATACAAGTCTCTCACCTTGTCACTGCCAGGAGACTGCCATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTGCCGCTGGCAAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCAGCCTGTGGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGGCTGTGAGTGACATCCTTCCCTCAGATTCTAAAGCCATCACAGACAGCAGCCCAATTCGTGTCCCTTTCCATTTCAAGTGGCCGGGTATTTTCTCCCTTATTATTGAATCTTGGACCACAAACTCAGCTGAACAGTCCACAGAAAACCCTGACAACCTTCTTAGTCGATTGGCTACACGTAGGCGTTTGTCTATTGGGGAGGACTGGTCCCAAGACATACACCTTGGACAGCAGAGTGAGTTGCGTTACTCCTACCATGTCTCTTGTGATGAGCATTATTATGGGGACAGCTGCTCTGATTACTGCAGACCGAGAGATGACAACTTTGGACATTACACTTGTGATGAGCAAGGGAACCGCTTATGCATGTCTGGCTGGAAAGGAGAATATTGCGCTGAACCTATCTGTCTACCTGGTTGCAGTGAGTCTCATGGGTTTTGTGAGCTACCCGGAGAATGTAAATGTCGCATGGGATGGCAAGGAGAACTGTGTGACGAATGTTTACGTTACCCTGGGTGCCAGCATGGATCCTGCTCCCAACCATGGGAGTGCATTTGTCAAGAAGGCTGGGGAGGGCTCTTTTGTAACCAGGACTTGAACTACTGTACCAACCACCAGCCATGCCGTAATGGAGCAAGCTGCATCAATATTGGCCAAGGGAGCTACTCTTGTAGCTGTCGTGCTGGCTTCACAGGAACCAATTGTGAAATAGACATCAATGAATGTGCGAGTAATCCATGCA
                                                  Xl3.1-CHK-1012698547          CCGAGCTGACACAAAGGAxxxxxxTCTGCAACCAAAxxxxxxCTCCGGAACCAAATAGCCAxTxxTTxxxxxCTGCCTTAAACTxTTTxxATCCAAATTCAATTTGCAACCAAAGATCCAACTTTTCAACCAAAATTCTCGCCCACCTCTACCCGCTTTAGACACACCAAGGACTATCTGATCGATTGCAGCATCCACAGCCAGCTCTGTCCAGTGCCACCGGCTACTTCGTTTGGTGCCATTCTAACTGGGCTCTGTGCAACAACATTGCTACTCCGGACATGCGAATGGTCTCAGCCTCATAGCGATCCCACCCCATCACTCTCTCCTGCCTTTCTGGAACTCCCGATACAAGTCTCTCACCTTGTCACTGCCAGGAGACTGCCATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTGCCGCTGGCAAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCAGCCTGTGGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGGCTGTGAGTGACATCCTTCCCTCAGATTCTAAAGCCATCACAGACAGCAGCCCAATTCGTGTCCCTTTCCATTTCAAGTGGCCGGGTATTTTCTCCCTTATTATTGAATCTTGGACCACAAACTCAGCTGAACAGTCCACAGAAAACCCTGACAACCTTCTTAGTCGATTGGCTACACGTAGGCGTTTGTCTATTGGGGAGGACTGGTCCCAAGACATACACCTTGGACAGCAGAGTGAGTTGCGTTACTCCTACCATGTCTCTTGTGATGAGCATTATTATGGGGACAGCTGCTCTGATTACTGCAGACCGAGAGATGACAACTTTGGACATTACACTTGTGATGAGCAAGGGAACCGCTTATGCATGTCTGGCTGGAAAGGAGAATATTGCGCTGAACCTATCTGTCTACCTGGTTGCAGTGAGTCTCATGGGTTTTGTGAGCTACCCGGAGAATGTAAATGTCGCATGGGATGGCAAGGAGAACTGTGTGACGAATGTTTACGTTACCCTGGGTGCCAGCATGGATCCTGCTCCCAACCATGGGAGTGCATTTGTCAAGAAGGCTGGGGAGGGCTCTTTTGTAACCAGGACTTGAACTACTGTACCAACCACCAGCCATGCCGTAATGGAGCAAGCTGCATCAATATTGGCCAAGGGAGCTACTCTTGTAGCTGTCGTGCTGGCTTCACAGGAACCAATTGTGAAATAGACATCAATGAATGTGCGAGTAATCCATGCAAGAATG
                                                      consensus depths         2     2     2     4     2     4     2     4     2     4     2     5     3     6     3     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     4     6     4     6     4     6     3     5     3     5     3     5     3     5     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     392    1229    
                                               BLH MIN     392     177    
                                               BLH MPR     362     177    
                                               BLH OVR     392    1242    
                                               CDS MIN     392     177    
                                               EST CLI      -3      15    
                                               ORF LNG     392      70    
  5   1   2       bld Ga18 5g3  out                     xlk123c13ex.5p GNCACAGCTCCGAGCTGACACAAAGGAAAGGAAGCTCTNNACCAAAGACAGCTCCGGAACCAAATAGCCAATTCTTTATCTCTGCCTTAAACTCTTTTGTATCCAAATTCAATTTGCAACCAAAGATCCAACTTTTCAACCAAAATTCTCGCCCACCTCTACCCGCTTTAGACACACCAAGGACTATCTGATCGATTGCAGCATCCACAGCCAGCTCTGTCCAGTGCCANNNNNNCTTCGTTTGGTGCCATTCTAACTGGGCTCTGTGCAACAACATTGCTACTCCGGACATGCGAATGGTCTCAGCCTCATAGCGATCCCACCCCATCACTCTCTCCTGCCTTTCTGGAACTCCCGATACAAGTCTCTCACCTTGTCACTGCCAGGAGACTGCCATGNNTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGNTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTNCCGCTGGNAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCAGNCTGTGGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGNNTGTGAGTGANATCCTNCCCTCAGANTCTAAAGCCATCACAGACAGCAGCCCAATTCGNGTCCCTTTNCATTTCANGNGNCNGGGNATTTTCTCCC
  5   1   2       bld Ga18 5g3  out                     xlk137h04ex.5p    ACAGCTCCGAGCTGACACAAAGGAAAGGAAGCTCTNNACCAAAGACAGCTCCGGAACCAAATAGCCAATTCTTTATCTCTGCCTTAAACTCTTTTGTATCCAAATTCAATTTGCAACCAAAGATCCAACTTTTCAACCAAAATTCTCGCCCACCTCTACCCGCTTTAGACACACCAAGGACTATCTGATCGATTGCAGCATCCACAGCCAGCTCTGTCCAGTGCCANNNNNNCTTCGTTTGGTGCCATTCTAACTGGGCTCTGTGCAACAACATTGCTACTCCGGACATGCGAATGGTCTCAGCCTCATAGCGATCCCACCCCATCACTCTCTCCTGCCTTTCTGGAACTCCCGATACAAGTCTCTCACCTTGTCAGTGCCAGGAGACTGCCATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTNCCGCTGGNAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCAGCCTGTGGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGNNTGTGAGTGACATCCTTCCCTCAGATTCTAAAGCCATCACAGACAGCAGCCCAATTCNNGTCCCTTTCCATTTCAAGTGGCCGGGNATTTTCTCCCTTAT
  5   1   2       bld Em10 5g                         IMAGE:7980540.5p        CCGAGCTGACACAAAGGAAAGGAAGCTCTGCAACCAAAGACAGCTCCGGAACCAAATAGCCAATTCTTTATCTCTGCCTTAAACTCTTTTGTATCCAAATTCAATTTGCAACCAAAGATCCAACTTTTCAACCAAAATTCTCGCCCACCTCTACCCGCTTTAGACACACCAAGGACTATCTGATCGATTGCAGCATCCACAGCCAGCTCTGTCCAGTGCCACCGGCTACTTCGTTTGGTGCCATTCTAACTGGGCTCTGTGCAACAACATTGCTACTCCGGACATGCGAATGGTCTCAGCCTCATAGCGATCCCACCCCATCACTCTCTCCTGCCTTTCTGGAACTCCCGATACAAGTCTCTCACCTTGTCAGTGCCAGGAGACTGCCATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTGCCGCTGGCAAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCAGCCTGTGGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGGCTGTGAGTGACATCCTTCCCTCAGATTCTAAAGCCATCACAGACAGCAGCCCAATTCGTGTCCCTTTCCATTTCAAGTGGCCGGGTATTTTCTCCCTTATTATTGAATCTTGGACCACAAACTCAGCTGAACAGTCCACAGAAAACCCTGA
  5   1   2       bld Emb4 5g                         IMAGE:5570232.5p          GAGCTGACACAAAGGAAAGGAAGCTCTGCAACCAAAGACAGCTCCGGAACCAAATAGCCAATTCTTTATCTCTGCCTTAAACTCTTTTGTATCCAAATTCAATTTGCAACCAAAGATCCAACTTTTCAACCAAAATTCTCGCCCACCTCTACCCGCTTTAGACACACCAAGGACTATCTGATCGATTGCAGCATCCACAGCCAGCTCTGTCCAGTGCCACCGGCTACTTCGTTTGGTGCCATTCTAACTGGGCTCTGTGCAACAACATTGCTACTCCGGACATGCGAATGGTCTCAGCCTCATAGCGATCCCACCCCATCACTCTCTCCTGCCTTTCTGGAACTCCCGATACAAGTCTCTCACCTTGTCACTGCCAGGAGACTGCCATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTGCCGCTGGCAAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCAGCCTGTGGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGGCTGTGAGTGACATCCTTCCCTCAGATTCTAAAGCCATCACAGACAGCAGCCCAATTCGTGTCCCTTTCCATTTCAAGTGGCCGGGTATTTTCTCCCTTATTATTGAAATCTTGGACCACAAACTCAGCTGGACAGTCCACAGAAAAACCTTGACAACTTTCTTAGTCGATTGGCTACACGTAAGCGTTTGGTCTATTGGGGGAGGGACTGGTCCCCAAGACATACACCCTTGGACAGGAAAAGTGAAGTT
  5   1   2       bld Ga12 5g3  out                        XL169c11.5p                                                     GCTCCGGAACCAATAGCCATTCTTTATCTCTGCCTTAAACTCTTTTGTATCAAATTCAATTTGCAACCAAAGATCCAACTTTTCAACCAAAATTCTCGCCCACCTCTACCCGCTTTAGACACACCAAGGACTATCTGATCGATTGCAGCATCCACAGCCAGCTCTGTCCAGTGCCACCGGCTACTTCGTTTGGTGCCATTCTAACTGGGCTCTGTGCAACAACATTGCTACTCCGGACATGCGAATGGTCTCAGCCTCATAGCGATCCCACCCCATCACTCTCTCCTGCCTTTCTGGAACTCCCGATACAAGTCTCTCACCTTGTCACTGCCAGGAGACTGCCATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTGCCGCTGGCAAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCAGCCTG
  5   1   2      seed Ga12 5g3  out                        XL172e16.5p                                                                     AATTCTTTATCTCTGCCTTAAACTCTTTTGTATCCAAATTCAATTTGCAACCAAAGATCCAACTTTTCAACCAAAATTCTCGCCCACCTCTACCCGCTTTAGACACACCAAGGACTATCTGATCGATTGCAGCATCCACAGCCAGCTCTGTCCAGTGCCACCGGCTACTTCGTTTGGTGCCATTCTAACTGGGCTCTGTGCAACAACATTGCTACTCCGGACATGCGAATGGTCTCAGCCTCATAGCGATCCCACCCCATCACTCTCTCCTGCCTTTCTGGAACTCCCGATACAAGTCTCTCACCTTGTCACTGCCAGGAGACTGCCATGGCTTCACCCCTGCTGCTTGTCTATGTAGCTGCGACTCTTTGCCTGCCGCTGGTGTATCCAGCTGGAGTTTTTGAGCTGAAAATCCACTCATTCAGCACTCCCCGCCCTGCGTGTGCCGCTGGCAAATCCTGCAACATTTTCTTCCGTGTGTGTCTCAAGCACGCTCAGCCTGTGGTGTCCCCCGACCCACCTTGTACTTTTGGCTCGGCTGTGAGTGACATCCTT
  5   1   2       bld Em10                            IMAGE:8317474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTCCCTCAGATTCTAAAGCCATCACAGACAGCAGCCCAATTCGTGTCCCTTTCCATTTCAAGTGGCCGGGTATTTTCTCCCTTATTATTGAATCTTGGACCACAAACTCAGCTGAACAGTCCACAGAAAACCCTGACAACCTTCTTAGTCGATTGGCTACACGTAGGCGTTTGTCTATTGGGGAGGACTGGTCCCAAGACATACACCTTGGACAGCAGAGTGAGTTGCGTTACTCCTACCATGTCTCTTGTGATGAGCATTATTATGGGGACAGCTGCTCTGATTACTGCAGACCGAGAGATGACAACTTTGGACATTACACTTGTGATGAGCAAGGGAACCGCTTATGCATGTCTGGCTGGAAAGGAGAATATTGCGCTGAACCTATCTGTCTACCTGGTTGCAGTGAGTCTCATGGGTTTTGTGAGCTACCCGGAGAATGTAAATGTCGCATGGGATGGCAAGGAGAACTGTGTGACGAATGTTTACGTTACCCTGGGTGCCAGCATGGATCCTGCTCCCAACCATGGGAGTGCATTTGTCAAGAAGGCTGGGGAGGGCTCTTTTGTAACCAGGACTTGAACTACTGTACCAACCACCAGCCATGCCGTAATGGAGCAAGCTGCATCAATATTGGCCAAGGGAGCTACTCTTGTAGCTGTCGTGCTGGCTTCACAGGAACCAATTGTGAAATAGACATCAATGAATGTGCGAGTAATCCATGCAAGAATGGGAGCAG
  5  -1   2      skin Brn2                             Brn2-za63b07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGCCATGCCGTAATGGAGCAAGCTGCATCAATACTGGCCAAGGGAGCTACTCTTGTAGCTGTCGTGCTGGCTTCACAGGAACCAATTGTGAAATAGACATCAATGAATGTGCGAGTAATCCATGCAAGAATGGAGGCAGTTGTAATGACCTGGAAAATGACTATGAATGTGTTTGCCCACGGGGTTTCTATGGAAAGAACTGTGATATCAGTGCTATGACATGTGAAGATGGCCCTTGCTTTAATGGAGGCACATGTATTGAGAAGAGCAGTGGAGTAGGATATGTCTGCCGATGTCCCTTCAACTACCATGGCTCTAACTGTGAAAAGAAGATTGATCGCTGTACCAACAGTCCCTGTCTGAATGGAGGTCAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)