Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk151d22ex.3                         6 END     1          16       16                Forkhead box protein A2-B (FoxA2-B) (FoxA2b) (Fork head domain-related protein 3') (xFD-3') (Hepatocyte nuclear factor 3-beta homolog-B) (HNF3beta homolog-B) (HNF-3beta-B) (HNF3beta-B) (xHNF3beta-B)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk155a03ex.3.5                      68 PI      80        681      950                novel forkhead box A family protein [Xenopus tropicalis]
     3   0.0    0Xl3.1-IMAGE:6863854.5                      65 PI      78        681      976                fork head domain protein [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:4203644-IMAGp.5                14 PI      80        623      984                Forkhead box protein A1 (FoxA1) (tFoxA1)
     5   0.0    0Xl3.1-IMAGE:5543595-IMAGp.5                12 PI      80        625      984                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012781157 Xl3.1-IMAGE:8319281.5 - 6 ESTs
                                                                       ....-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8319281.5                                                                           CAGCACCTCTTCCTACTTCAGTTTCCCTGAAACCCTTTCCCACTCCCTGAGCAGCCCCTCTGGCTGCCCATTCGTGCCCAGCAGCAGCAGCAGCAGCCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCTCTCTCTCTTTTTTTTGTTGCTATTGCTGTCGTAGTTGTTGTAGCTGTTAAATTTTAAACTGCAAGGCACTCAGCTTCCAGTATGCTTGGGGCTGTGAAAATGGAAGGACACGAAGCTACAGATTGGAGCAGCTACTACGGGGAAGCAGAGGCTTACTCGTCGGTGGGCAATATGAACGCTGGGCTGAGCATGAATCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCAGCTCCATGAACATGTCCTATGTGAACACGGGCATGAGCCCATCACTGACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGCATGGGCACGGGGGTCCCCAGCATGGCAAGTCACCTGAGCCCCAGTATGAGCCCGATGAGCGCCCAGACAACTGCAATGAATGCCCTGGCACCCTATACCAACATCAACTCCATGAGCCCAATTTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAAACCTACAGGCGAAGTTATACGCACGCAAAGCCCCCCTACTCGTACATCTCTCTAATCACCATGGCCATCCAGCAGTCCCCCAGCAAGATGTTGACGCTGAGCGAGGTCTATCAGTGGATCATGGACTTGTTCCCTTTTTACAGGCAGAATCAGCAGCGCTGGCAGAACTCTATTCGTCATTCCCTATCCTTTAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCCGACAAACCTGGCAAGGGCTCCTTCTGGACCCTACACCCGGTTTCGGGCAACATGTTTGAGAATGGCTGTTACCTGCGGCGACAGAAACGATTCAAGTGCGATAAAAAGCCCAGCCTGAGGGAAGGGGGAGGCAAGAAACTTTCAGAAGGGGCATCAAGTGTGGGCTCTGTGGGCAACAGCAGCTCTGAGCGTTCAGTGGGCAATGAGTCTCCACACTCCAGCTCGT
                                                  Xl3.1-CHK-1012702474                                                                                 CTCTTCCTACTTCAGTTTCCCTGAAACCCTTTCCCACTCCCTGAGCAGCCCCTCTGGCTGCCCATTCGTGCCCAGCAGCAGCAGCAGCAGCCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCTCTCTCTCTTTTTTTTGTTGCTATTGCTGTCGTAGTTGTTGTAGCTGTTAAATTTTAAACTGCAAGGCACTCAGCTTCCAGTATGCTTGGGGCTGTGAAAATGGAAGGACACGAAGCTACAGATTGGAGCAGCTACTACGGGGAAGCAGAGGCTTACTCGTCGGTGGGCAATATGAACGCTGGGCTGAGCATGAATCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCAGCTCCATGAACATGTCCTATGTGAACACGGGCATGAGCCCATCACTGACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGCATGGGCACGGGGGTCCCCAGCATGGCAAGTCACCTGAGCCCCAGTATGAGCCCGATGAGCGCCCAGACAACTGCAATGAATGCCCTGGCACCCTATACCAACATCAACTCCATGAGCCCAATTTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAAACCTACAGGCGAAGTTATACGCACGCAAAGCCCCCCTACTCGTACATCTCTCTAATCACCATGGCCATCCAGCAGTCCCCCAGCAAGATGTTGACGCTGAGCGAGGTCTATCAGTGGATCATGGACTTGTTCCCTTTTTACAGGCAGAATCAGCAGCGCTGGCAGAACTCTATTCGTCATTCCCTATCCTTTAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCCGACAAACCTGGCAAGGGCTCCTTCTGGACCCTACACCCGGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGCGGCGACAGAAACGATTCAAGTGCGATAAAAAGCCCAGCCTGAGGGAAGGGGGAGGCAAGAAACTTTCAGAAGGGGCATCAAGTGTGGGCTCTGTGGGCAACAGCAGCTCTGAGCGTTCAGTGGGCAATGAGTCTCCACACTCCAGCTCGTCTCCCT
                                                      consensus depths                                                                                2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2
                                               BLH ATG     236     814                                                                           
                                               BLH MIN     221     156                                                                           
                                               BLH MPR      47     156                                                                           
                                               BLH OVR     236    1037                                                                           
                                               ORF LNG     236      49                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 9e-050     NP_001041116.1 defective PHArynx development family member (pha-4) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Ci ==== 2e-062     AAT74646.1 forkhead [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Ag ==== 6e-063     XP_321425.3 AGAP001671-PA [Anopheles gambiae str. PEST] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                PROTEIN --- Dm ---- 8e-064     NP_524542.1 fork head CG10002-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sp ---- 2e-068     NP_001073010.1 forkhead transcription factor A [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Bt ==== 2e-096     XP_613201.1 PREDICTED: similar to forkhead box A1 [Bos taurus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                 PREDICTED - ?? ---- 6e-111     XP_599153.4 PREDICTED: forkhead box A2 [Bos taurus] ----------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 2e-123     NP_034576.2 forkhead box A2 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 4e-124     NP_710141.1 forkhead box A2; hepatic nuclear factor-3-beta; hepatocyte nuclear factor 3,beta [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Cf ==== 7e-125     XP_542865.2 PREDICTED: similar to forkhead box A2 [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Dr ==== 2e-132     NP_571024.1 forkhead box A2; axial [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 1e-134     NP_990101.1 transcription factor Foxa2 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 1e-161     CAJ82886.1 forkhead box A2 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 6e-164     Q91765.1 Forkhead box protein A2-A (FoxA2-A) (FoxA2a) (Fork head domain-related protein 3) (xFD-3) (Hepatocyte nuclear factor 3-beta homolog A) (HNF3-beta homolog A) (HNF-3-beta-A) (HNF3-beta-A) (xHNF3-beta-A) (xbeta-1) [Xenopus laevis]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8319281.5                                                                                                                          TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------ATG---------------ATG---------------------------------------------------------------------ATG---------------ATG------ATG---------ATG---ATG------ATG---------------ATG------------ATG---ATG------------------ATG------------------ATG------------------ATG------ATG------------------ATG---------------------ATG------ATG------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   2       bld DMZ  5g                              xl309c02.5p CAACGTCACTGCAAGACTTGCAATCATCATCATCATCCTCCTCTTCAGCAGCACCCTGAGGTCTTTTTCAGCTCCTGCAGCACCTCTTCCTACTTCAGTTTCCCTGAAACCCTTTCCCACTCCCTGAGCAGCCCCTCTGGCTGCCCATTCGTGCCcagcagcagcagcagcCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCTCTCTCTCttttttttGTTGCTATTGCTGTCGTAGTTGTTGTAGCTGTTAAATTTTAAACTGCAAGGCACTCAGCTTCCAGTATGCTTGGGGCTGTGAAAATGGAAGGACACGAAGCTACAGATTGGAGCAGCTACTACGGGGAAGCAGAGGCTTACTCGTCGGTGGGCAATATGAACGCTGGGCTGAGCATGAATCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCAGCTCCATGAACATGTCCTATGTGAACACGGGCATGAGCCCATCACTGACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGCATGGGCACGGGGGTCCCCAGCATGGCAAGTCACCTGAGCCCCAGTATGAGCCCGATGAGCGCCCAGACAACTGCAATGAATGCCCTGGCACCCTATACCAACATCAACTCCATGAGCCCAATTTATGGAC
  5   1   2       bld Neu7 5g                              XL016l12.5p                                       GCTTCAGCAGCACCCTGNGGTCTTTTTCAGCTCCTGCAGCACCTCTTCCTACTTCAGTTTCCCTGAAACCCTTTCCCACTCCCTGAGCAGCCCCTCTGGCTGCCCATTCGTGCCcagcagcagcagcagcagcCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCTCTCTCTCttttttttGTTGCTATTGCTGTCGTAGTTGTTGTAGCTGTTAAATTTTAAACTGCAAGGCACTCAGCTTCCAGTATGCTTGGGGCTGTGAAAATGGAAGGACACGAAGCTACAGATTGGAGCAGCTACTACGGGGAAGCAGAGGCTTACTCGTCGGTGGGCAATATGAACGCTGGGCTGAGCATGAATCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCAGCTCCATGAACATGTCCTATGTGAACACGGGCATGAGCCCATCACTGACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGCATGGGCACGGGGGTCCCCAGCATGGCAAGTCACCTGAGCCCCAGTATGAGCCCGATGAGCGCCCAGACAACTGCAATGAATGCCCTGGCACCCTATACCAACATCAACTCCATGAGCCCAATTTATGGACAGTCCAACATCAACAGATCCA
  5   1   2       bld Neu7 5g                              XL016i24.5p                                                        AGGGTCTTTTTAGCTCCTGCAGCACCTCTTCCTACTTCAGTTTCCCTGAAACCCTTTCCCACTCCCTGAGCAGCCCCTCTGGCTGCCCATTCGTGCCcagcagcagcagcagcagcCACCTCCAGCCTTCCCCCTCCTAGTGATCAGAGAGGAAGAGGGAGGGTTCCTGGCTCTCTCTCTCttttttttGTTGCTATTGCTGTCGTAGTTGTTGTAGCTGTTAAATTTTAAACTGCAAGGCACTCAGCTTCCAGTATGCTTGGGGCTGTGAAAATGGAAGGACACGAAGCTACAGATTGGAGCAGCTACTACGGGGAAGCAGAGGCTTACTCGTCGGTGGGCAATATGAACGCTGGGCTGAGCATGAATCCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCAGCTCCATGAACATGTCCTATGTGAACACGGGCATGAGCCCATCACTGACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGCATGGGCACGGGGGTCCCCAGCATGGCAAGTCACCTGAGCCCCAGTATGAGCCCGATGAGCGCCCAGACAACTGCAATGAATGCCCTGGCACCCTATACCAACATCAACTCCATGAGCCCAATTTATGGA
  5   1   2       bld Ga15      out                      XL508j17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  CATGAACCCCATGAACACTTACATGAGCATGTCTGCTATGAGCACCTCGGCTAACATGACTGCCAGCTCCATGAACATGTCCTATGTGAACACAGGAATGAGTCCGTCGATCACTGGCATGTCTCCTGGCACGGGGGCAATGCCTGGCATGGGCAACGGGGTCGCCAGCATGGCAAGTCACCTGAGCCCCAGTATGAGCCCGATGAGTGCCCAGGCTACTTCAATGAATGCCCTGGCTCCCTACACCAACATCAACTCCATGAGCCCAATCTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAAACCTACAGGCGAAGTTATACGCACGCAAAGCCCCCCTACTCGTACATCTCTCTAATCACCATGGCCATCCAGCAGTCCCCCAGCAAGATGTTGACGCTGAGCGAGGTCTATCAGTGGATCATGGACTTGTTCCCTTTTTACAGGCAGAATCAGCAGCGCTGGCAGAACTCTATTCGTCATTCCCTATCCTTTAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCCGACAAACCTGGCAAGGGCTCCTTCTGGACCCTACACCCGGATTCGGGCAACATGTTTGAGAATGGCTGTTACCTGCGGCGACAGAAACGATTCAAGTGCGATAAAAAGCCCAGCCTGAGGGAAGGGGGAGGCAAGAAACTTTCAGAAGGGGCATCAAGTGTGGGCTCTGTGGGCAACAGCAGCTCTGAGCGTTCAGTGGGCAATGAGTCTCCACACTCCAGCTCGTCTCCCTGCCA
  5   1   2      seed Em10                            IMAGE:8319281.5p                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATCCATGAACACGTACATGAGCATGTCTGCTATGAGCACCTCGGCCAACATGACCGCCAGCTCCATGAACATGTCCTATGTGAACACGGGCATGAGCCCATCACTGACCGGCATGTCTCCTGGCACCGGGGCAATGACTGGCATGGGCACGGGGGTCCCCAGCATGGCAAGTCACCTGAGCCCCAGTATGAGCCCGATGAGCGCCCAGACAACTGCAATGAATGCCCTGGCACCCTATACCAACATCAACTCCATGAGCCCAATTTATGGACAGTCCAACATCAACAGATCCAGGGACCCCAAAACTTACCGGCGAAGTTACACACATGCCAAGCCCCCCTACTCATACATCTCGCTCATCACCATGGCCATCCAGCAGTCCCCCAACAAGATGCTGACGCTGAGTGAGATCTATCAGTGGATCATGGACCTGTTCCCTTTCTACAGGCAGAACCAGCAGCGATGGCAGAACTCTATCCGCCATTCCCTTTCCTTTAATGACTGTTTCCTCAAGGTGCCCAGGTCCCCGGACAAGCCTGGAAAAGGTTCCTTCTGGACCCTACACCCTGATTCGGGCAACATGTTTGAGAACGGCTGTTACCTGCGGCGACAGAAACGCTTCAAGTGCGAGAAAAAGCCCAGCCTTAGGGAAGGGGGAGGCAAGAAACTTTCAGAAAGGGCATCGAGTGTGGGCTCTGCGGCCAACAGCA
  5   1   2       bld Tad1                            IMAGE:6939753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGACCCCAAAACCTACAGGCGAAGTTATACGCACGCAAAGCCCCCCTACTCGTACATCTCTCTAATCACCATGGCCATCCAGCAGTCCCCCAGCAAGATGTTGACGCTGAGCGAGGTCTATCAGTGGATCATGGACTTGTTCCCTTTTTACAGGCAGAATCAGCAGCGCTGGCAGAACTCTATTCGTCATTCCCTATCCTTTAATGACTGTTTTCTCAAGGTGCCCAGGTCCCCCGACAAACCTGGCAAGGGCTCCTTCTGGACCCTACACCCGGTTTCGGGCAACATGTTTGAGAATGGCTGTTACCTGCGGCGACAGAAACGATTCAAGTGCGATAAAAAGCCCAGCCTGAGGGAAGGGGGAGGCAAGAAACTTTCAGAAGGGGCATCAAGTGTGGGCTCTGTGGGCAACAGCAGCTCTGAGCGTTCAGTGGGCAATGAGTCTCCACACTCCAGCTCGTCTCCCTGCCAGGAGCAGAAAAGGTCACTTGTAGATATGAAGTCCAGCCACGGCTTGAGCCCAGAGCATGCCACCTCCCCAGCCCTCCAAGCCCAGCACTTGCTTTCCCAACACCACTCAGTCCTGTCCCATGAAGCCCAGTCCCACCCTCAAACCAGAACACCATTATTTCTTTCAACCCACCCCTTCTCCATCAACAAACCTCCATGTCCCTCCGGAGCAACAGGaaccacccaccacccaccatttgccacaacccacccaggcaaccaccCATATAAAATGGAAACTTTGAAAGCCCTTACCAAACAGGGGTGATGCCACCN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)