Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL442a22ex.5                          9 END     1           9       11                Unknown (protein for IMAGE:5156648) [Xenopus laevis]
     2   1.0    0Xl3.1-IMAGE:6634794.5                       4 END     1           9       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL442a22ex.5                          9 PI      93          1      723                Unknown (protein for IMAGE:5156648) [Xenopus laevis]

 This cluster: approximate FL confidence score = 89%

 1012781293 Xl3.1-XL448i12ex.5 - 11 ESTs
                                                                       ........-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL448i12ex.5                                                                                                                                                                                                                                               GGAAAAGGGAGCACGGAGCGAGGACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATTGATGGCACAGAGAAGACCGAATGCACAGAAGAAGAAAGCATTATAGAACACACGTATAGCACAGCCGAGTTTGTCAGCCAGTCTATTGACATCAACGAGCCAATTGGAAATCTCAAGAAGTTGCTGGAGCCGAGACTTCAGTGTTCGCTAGATGCACATGAAATATGTTTGCAAGATATCCAGCTTGATCCTGATCGCAGTTTATTTGACCAAGGAGTAAAGACAGATGGATCAGTACAGCTCAGTGTTCAGGTGATCTCTCAGCAAGGGCTGGAGCCAAAACTAAACATCTTGGAAATTGTGAAGCCAGTGGAGACCGTTGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTAGAAGCTGAACTGGTTGAGGAAGCACAGGTGATCACTCTGGATGGGTCAAAACACATAACAACAATTTCTGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCATTGGAAGGCTACAGAAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAATGGTCTGTTGATCAGGTTCTTCACTGGGTGCTCTGGGTAATGAAGGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAGCCAAGAAGACTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCGAGCCAGGAACAGGGAGGCGAAATTGCAACAGTTACCATTGATCAGCCTGTGCATATTATACCAGCATCAATCCAACCAACCGCACAAACAACCATTAAAGTAATAAATAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGCGAAGACCGAAGTTCACCAGGAAACAGAACAGGGAACAATGGGCAGATCCAGCTATGGCAGTTTCTTCTAGAATTGCTCACTGACAAAGACGCTAGAGACTGTATTTCATGGGTTGGTGATGAAGGAGAATTCAAATTAAACCAGCCAGAATTGGTAGCACAAAAATGGGGACAGCGAAAAAACAAGCCCACCATGAATTATGAAAAACTTAGCCGTGCTTTACGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACCCTAATTGGCTACAGCGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCGAAGATGCAATTACACAGCATTGGGCAGCCTATGACAGCAGTCACACTGGCTACCGCTTCTCTTCAAAAATAATAATTGGGCTCTGCAGGAACTCAAACTGATACTTTCCATCTGTGCATTGGTCCTCCTTTATTGGATTCTGATGCCTTTTTATTTGCAGACCTCACACTAAAAGGCATGATTATTTTGGGGGTTTTTTTTTTGAAAGAGACTTGGACTTCATTACACTTGGATCTTGTAACATTTGTTTACAGTTACCTTTGTTCATGAAGCATGGCTTATATTCAACATGAACTTAATGAGCTCAACTCTTTCTAATGAGCTTAAGCCTTCTCCA
                                                  Xl3.1-CHK-1012695156                                                                                                                                                                                                                                                     GGGAGCACGGAGCGAGGACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATTGATGGCACAGAGAAGACCGAATGCACAGAAGAAGAAAGCATTATAGAACACACGTATAGCACAGCCGAGTTTGTCAGCCAGTCTATTGACATCAACGAGCCAATTGGAAATCTCAAGAAGTTGCTGGAGCCGAGACTTCAGTGTTCGCTAGATGCACATGAAATATGTTTGCAAGATATCCAGCTTGATCCTGATCGCAGTTTATTTGACCAAGGAGTAAAGACAGATGGATCAGTACAGCTCAGTGTTCAGGTGATCTCTCAGCAAGGGCTGGAGCCAAAACTAAACATCTTGGAAATTGTGAAGCCAGTGGAGACCGTTGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTAGAAGCTGAACTGGTTGAGGAAGCACAGGTGATCACTCTGGATGGGTCAAAACACATAACAACAATTTCTGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCATTGGAAGGCTACAGAAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAATGGTCTGTTGATCAGGTTCTTCACTGGGTGCTCTGGGTAATGAAGGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAGCCAAGAAGACTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCGAGCCAGGAACAGGGAGGCGAAATTGCAACAGTTACCATTGATCAGCCTGTGCATATTATACCAGCATCAATCCAACCAACCGCACAAACAACCATTAAAGTAATAAATAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACCGAAGTTCACCAGGAAACAGAACAGGGAACAATGGGCAGATCCAGCTATGGCAGTTTCTTCTAGAATTGCTCACTGACAAAGACGCTAGAGACTGTATTTCATGGGTTGGTGATGAAGGAGAATTCAAATTAAACCAGCCAGAATTGGTAGCACAAAAATGGGGACAGCGAAAAAACAAGCCCACCATGAATTATGAAAAACTTAGCCGTGCTTTACGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACCCTAATTGGCTACAGCGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCGAAGATGCAATTACACAGCATTGGGCAGCCTATGACAGCAGTCACACTGGCTACCGCTTCTCTTCAAAAATAATAATTGGGCTCTGCAGGAACTCAAACTGATACTTTCCATCTGTGCATTGGTCCTCCTTTATTGGATTCTGATGCCTTTTTATTTGCAGACCTCACACTAAAAGGCATGATTATTTTGGGGGTTTTTTTTTTGAAAGAGACTTGGACTTCATTACACTTGGATCTTGTAACATTTGTTTACAGTTACCTTTGTTCATGAAGCATGGCTTATATTCAACATGAACTTAATGAGCTCAACTCTTTCTAATGAGCTTAAGCCTTCTCCACAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     3     3     3     3     3     2     3     3     3     3     5     3     5     3     6     2     5     3     5     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     4     3     4     4     4     3     4     4     4     4     4     3     3     3     3     3     3     3     3     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     3     5     3     5     3     4     3     4     3     4     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     1     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      44     503                                                                                                                                                                                                                                               
                                               BLH MIN      23     286                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-028     NP_508865.1 friend leukemia integration 1 like (XF694) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 2e-071     NP_524523.2 Ets at 97D CG6338-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 5e-077     NP_001071725.1 GA repeat binding protein alpha homolog [Ciona intestinalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 6e-078     XP_313616.4 AGAP004337-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 3e-104     XP_001178496.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 0          NP_571662.1 E4tf1-60 transcription factor [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 0          NP_032091.2 GA repeat binding protein, alpha [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Bt ==== 0          NP_001068905.1 GA binding protein transcription factor, alpha subunit 60kDa [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 0          NP_002031.2 GA binding protein transcription factor, alpha subunit (60kD); GA-bindingprotein transcription factor, alpha subunit (60kD); human nuclear respiratoryfactor-2 subunit alpha [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Cf ==== 0          XP_535570.1 PREDICTED: similar to GA binding protein transcription factor, alpha subunit (60kD) [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 0          NP_001007859.1 GA binding protein transcription factor, alpha subunit [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 0          NP_001116494.1 GA binding protein transcription factor, alpha subunit 60kDa [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          NP_001086894.1 GA binding protein transcription factor, alpha subunit 60kDa [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL448i12ex.5                                                                                                                                                                                                                                                                                           ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------ATG------------------------------------TAATAA------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TGA---ATG---------------------------------------TAATGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Ga12      in                         XL172b04.5p                                                                                                                                                                                       NCTTCATTTCCGTTGTGTGTGAGTCCGGGGGGGTGTTTAAAAGAAGAAAGTGCAGGGGAAAAGGGAGCACGGAGCGAGGACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATTGATGGCACAGAGAAGACCGAATGCACAGAAGAAGAAAGCATTATAGAACACACGTATAGCACAGCCGAGTTTGTCAGCCAGTCTATTGACATCAACGAGCCAATTGGAAATCTCAAGAAGTTGCTGGAGCCGAGACTTCAGTGTTCGCTAGATGCACATGAAATATGTTTGCAAGATATCCAGCTTGATCCTGATCGCAGTTTATTTGACCAAGGAGTAAAGACAGATGGATCAGTACAGCTCAGTGTTCAGGTGATCTCTCAGCAAGGGCTGGAGCCAAAACTAAACATCTTGGAAATTGTGAAGCCAGTGGAGACCGTTGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTAGAAGCTGAACTGGTTGAGGAAGCACAGGTGATCACTCTGGATGGGTCAAAACACATAACAACAATTTCTGATGAAACATCC
  5   1   2       bld Ga12 5g3  in                         XL182i20.5p                                                                                                                                                                                                                                               GGAAAAGGGAGCACGGAGCGAGGACTACTTCTAATATTGTAGCCATGACAAAAAGAGAGGCTGAGGAGTTGATAGAGATAGAAATTGATGGCACAGAGAAGACCGAATGCACAGAAGAAGAAAGCATTATAGAACACACGTATAGCACAGCCGAGTTTGTCAGCCAGTCTATTGACATCAACGAGCCAATTGGAAATCTCAAGAAGTTGCTGGAGCCGAGACTTCAGTGTTCGCTAGATGCACATGAAATATGTTTGCAAGATATCCAGCTTGATCCTGATCGCAGTTTATTTGACCAAGGAGTAAAGACAGATGGATCAGTACAGCTCAGTGTTCAGGTGATCTCTCAGCAAGGGCTGGAGCCAAAACTAAACATCTTGGAAATTGTGAAGCCAGTGGAGACCGTTGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTAGAAGCTGAACTGGTTGAGGAAGCACAGGTGATCACTCTGGATGGGTCAAAACACATAACAACAATTTCTGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCATTGGAAGGCTACAGAAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCGCTTCAATGGTCTGTTGATCAGGTTCTTCACTGGGTGCTCTGGGTAATGAAGGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTAT
  5   1   2      seed Ga15      in                       XL448i12ex.5p                                                                                                                                                                                                                                                                                                                 AGTTGATAGAGATAGAAATTGATGGCACAGAGAAGACCGAATGCACAGAAGAAGAAAGCATTATAGAACACACGTATAGCACAGCCGAGTTTGTCAGCCAGTCTATTGACATCAACGAGCCAATTGGAAATCTCAAGAAGTTGCTGGAGCCGAGACTTCAGTGTTCGCTAGATGCACATGAAATATGTTTGCAAGATATCCAGCTTGATCCTGATCGCAGTTTATTTGACCAAGGAGTAAAGACAGATGGATCAGTACAGCTCAGTGTTCAGGTGATCTCTCAGCAAGGGCTGGAGCCAAAACTAAACATCTTGGAAATTGTGAAGCCAGTGGAGACCGTTGAAGTGGTAATTGACCCAGATGCCCATCAAGATGCAGTAGAAGCTGAACTGGTTGAGGAAGCACAGGTGATCACTCTGGATGGGTCAAAACACATAACAACAATTTCTGATGAAACATCCGAGCAAGTAACCCGGTGGGCAGCAGCATTGGAAGGCTACAGAAAGGAGCAAGAACGCTTAGGCATTCCATATGATCCACTTCAATGGTCTGTTGATCAGGTTCTTCACTGGGTGCTCTGGGTAATGAAGGAATTCTGTTTGACTGAAATAAATGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAGCCAAGAAGACTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCGAGCCAGGAACAGGGAGGCGAAATTGCAACAGTTACCATTGATCAGCCTGTGCACATTATACCAGCATCAATCCAACCAACCGCACAAACAACCATTAAAGTAATAA
  3   1   1       add Ga15      out                      XL445e10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGAAAGAGCAAGANCGCTTAGGCATTCCATATGATCCNCTTCAATGGTCNGTAGATCAGGTTCTTCATTGGGTGCTNTGGNTAATGAAGGAATTCGGTTNGACTGATATAAATGTGANCTCCCTCGGTATAACGGGAAGAGAAGCTCTGCAACCTTAATCAAGAAGATTTCTTCCAGAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTCGGAAATATTGTTTTGGCGAGTCAGGGAAACAGGGAGGNGAAATTGCAACAGTTACC
  3  -1   2       bld Ga11                            IMAGE:3474836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAAGCTCAGAATAAACGCTCAACTTTGGCAGTTCTCCCTTCCCCGGGCAGGAAGAGAACTCTGCAACCTTAGCCAAGAAGACTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTTGCGAGCCAGGAACAGGGAGGCGAAATTGCAACAGTTACCATTGATCAGCCTGTGCATATTATACCAGCATCAATCCAACCAACCGCACAAACAACCATTAAAGTAATAAATAGTCAAACCAAAGTAGTAAAAATACAAAGGACGCCGCGCATTTCTGGCGAAGACCGAAGTTCACCAGGAAACAGAACAGGGAACAATGGGCAGATCCAGCTATGGCAGTTTCTTCTAGAATTGCTCACTGACAAAGACGCTAGAGACTGTATTTCATGGGTTGGTGATGAAGGAGAATTCAAATTAAACCAGCCAGAATTGGTAGCACAAAAATGGGGACAGCGAAAAAACAAGCCCACCATGAATTATGAAAAACTTAGCCGTGCTTTACGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACC
  5   1   2       add Neu4                            IMAGE:3475728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTGAAGAGTTCTCTTCCTGTTATACCGAGGGAGTTCACATTTATATCAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAGAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCTTTTTTTGCTTNTTCGGAAATATGTTTTGGCGAGTCAGGAACAGGGAGGCGAAATAcccccccccACCATTGATCACCCTGTACAGATTATACCAGCATTAATCCAGCCCTCAGCGCAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGGCGCCACGCATTTCTGGGGAAGACAGAAGTTCACCAGGAAACAGAACAGGGAACAATGGGCAGATACAGTTATGGCAGTCTCTCTTAGAATCGCTCACTGACAAAGACGCTAGAGACTGTATTCTATGGGTTGGCGACCAAAGAGAATTAAAACTGAACCCGCCAGAACTGGTGGGCCATAAATGGGGA
  5   1   2      skin Ga12                                 XL151l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAGCCAGAAGACTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCGAGCCAGGAACAGGGAGGCGAAATTGCAACAGTTACCATTGATCAGACTGTGCATATTATACCAGCATCAATCCAACCAACCGCACAAACAACCATTAAAGTAATAAATAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACCGAAGTTCACCAGGAAACAGAACAGGGAACAATGGGCAGATCCAGCTATGGCAGTTTCTTCTAGAATTGCTCACTGACAAAGACGCTAGAGACTGTATTTCATGGGTTGGTGATGAAGGAGAATTCAAATTAAACCAGCCAGAATTGGTAGCACAAAAATGGGGACAGCGAAAAAACAAGCCCACCATGAATTATGAAAAACTTAGCCGTGCTTTACGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACCCTAATTGGCTACAGCGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCGAAGATGCAATTACACAGCATTGGGCAGCCTATGACAGCAGTCACACTGGCTAC
  5   1   1       add Neu7      out                        XL024l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGCTGttttttcttccttgttttgtgacaaaaagtcatgggatttcccttccTGGTTCGGCCGAATCCAAATCCTGCTGAAAAAGGCCTCCCTAGTTATTATTTGTAATAATAATTTTATTCTATAATTGGTAATTGTAGATTACAGTTAAGCGCGCACACAGAGGGGTTGGAGGGTCCTAAAGTTCCACTATGAAGAACAAAACTATTGTATTTGTTTTTGTTTTCCGTGTAGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACCCTAATTGGCTACAGCGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCGAAGATGCAATTACACAGCATTGGGCAGCCTATGACAGCAGTCACACTGGCTACCGCTTCTCTTCAAAAATAATAATTGGGCTCTGCAGGAACTCAAACTGATACTTTCCATCTGTGCATTGGTCCTCCTTTATTGGATTCTGATGCCTTTTTATTTGCAGACCTCACACTAAAAGGCATGATTATTTTGGGGGGGttttttttttGA
  3   1   2       add Ga15      in                       XL448i12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGATGAAGGAGAATTCAAATTAAACCAGCCAGAANTGGTAGCACAAAAANGGGGACAGCGNAAAAACAAGCCCNCCATGAATTANGANAAACNTAGCCGTGCNTTNCGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACCCTAATTGGCTACAGCGCAGCAGAACTGAGTCGGCTGGNGGCAGAATGTGAACAAAAGAAAATGGCGAAGATGCAATTACACAGCATTGGGCAGCCTATGACAGCAGTCNCNCTGGNTNCCGCTTCTCTTCAAAAATAATAATTGGGCTNTGCAGGAACTCAAACTGATACTTTCCATNTGNGCATTGGTCCTCCTTTATTGGATTNTGATGCCTTTTTATTTGCAGACCTCACNCTAAAAGGCATGATTATTTTGGGGGTTTTTTTTTTGAAAGAGACTTGGACTTCATTACACTTGGATCTTGTAACATTTGTTTACAGTTACCTTTGTTCATGAAGCATGGCTTATATTCAACATGAACTTAATGAGCTCAACTCTTTCTAATGAGCTTAAGCCTTCTCCACAAAAATC
  3   1   2       bld Ga12      in                         XL172b04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAAACTTAGCCGTGCTTTACGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATNTCAAGACCCTAATTGGCTACAGC
  3   1   0       add Ga12 5g3  in                         XL182i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNCTGGNTNCCGNTTTTTTTCAAAAATAATAATTGGGCTTTGCAGGAACTCAAACTGATNCTTTCCATNTGNGCNNTGGTCCTCCTTTATTGGATTTTGANGCCTTTTTATTTGCAGNCCTCNCNCTAAAAGGCATGATTNTTTTGGGGGTTTTTTTTTTTGAAAGAGACTTGGACTTCATTACACTTGGATCTTGTAACATTTGTTTACAGTTACCTTTGTTCATGAAGCATGGCTTATATTCAACATGAACTTAATGAGCTCAACTCTTTCTAATGAGCTTAAGCCTTCTCCACAAAAATCATCTTCATTATAAAGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)