Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL442a22ex.5                          9 END     1           9       11                Unknown (protein for IMAGE:5156648) [Xenopus laevis]
     2   1.0    0Xl3.1-IMAGE:6634794.5                       4 END     1           9       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL442a22ex.5                          9 PI      93          1      723                Unknown (protein for IMAGE:5156648) [Xenopus laevis]

 This cluster: approximate FL confidence score = 89%

 1012781293 Xl3.1-XL448i12ex.5 - 11 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     3     3     3     3     3     2     3     3     3     3     5     3     5     3     6     2     5     3     5     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     4     3     4     4     4     3     4     4     4     4     4     3     3     3     3     3     3     3     3     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     3     5     3     5     3     4     3     4     3     4     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     1     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      44     503                                                                                                                                                                                                                                               
                                               BLH MIN      23     286                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-028     NP_508865.1 friend leukemia integration 1 like (XF694) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 2e-071     NP_524523.2 Ets at 97D CG6338-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 5e-077     NP_001071725.1 GA repeat binding protein alpha homolog [Ciona intestinalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 6e-078     XP_313616.4 AGAP004337-PA [Anopheles gambiae str. PEST] ------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 3e-104     XP_001178496.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 0          NP_571662.1 E4tf1-60 transcription factor [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 0          NP_032091.2 GA repeat binding protein, alpha [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Bt ==== 0          NP_001068905.1 GA binding protein transcription factor, alpha subunit 60kDa [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 0          NP_002031.2 GA binding protein transcription factor, alpha subunit (60kD); GA-bindingprotein transcription factor, alpha subunit (60kD); human nuclear respiratoryfactor-2 subunit alpha [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Cf ==== 0          XP_535570.1 PREDICTED: similar to GA binding protein transcription factor, alpha subunit (60kD) [Canis familiaris] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 0          NP_001007859.1 GA binding protein transcription factor, alpha subunit [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 0          NP_001116494.1 GA binding protein transcription factor, alpha subunit 60kDa [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          NP_001086894.1 GA binding protein transcription factor, alpha subunit 60kDa [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL448i12ex.5                                                                                                                                                                                                                                                                                           ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------ATG------------------------------------TAATAA------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TGA---ATG---------------------------------------TAATGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  3   1   1       add Ga15      out                      XL445e10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGAAAGAGCAAGANCGCTTAGGCATTCCATATGATCCNCTTCAATGGTCNGTAGATCAGGTTCTTCATTGGGTGCTNTGGNTAATGAAGGAATTCGGTTNGACTGATATAAATGTGANCTCCCTCGGTATAACGGGAAGAGAAGCTCTGCAACCTTAATCAAGAAGATTTCTTCCAGAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTCGGAAATATTGTTTTGGCGAGTCAGGGAAACAGGGAGGNGAAATTGCAACAGTTACC
  3  -1   2       bld Ga11                            IMAGE:3474836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAAGCTCAGAATAAACGCTCAACTTTGGCAGTTCTCCCTTCCCCGGGCAGGAAGAGAACTCTGCAACCTTAGCCAAGAAGACTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTTGCGAGCCAGGAACAGGGAGGCGAAATTGCAACAGTTACCATTGATCAGCCTGTGCATATTATACCAGCATCAATCCAACCAACCGCACAAACAACCATTAAAGTAATAAATAGTCAAACCAAAGTAGTAAAAATACAAAGGACGCCGCGCATTTCTGGCGAAGACCGAAGTTCACCAGGAAACAGAACAGGGAACAATGGGCAGATCCAGCTATGGCAGTTTCTTCTAGAATTGCTCACTGACAAAGACGCTAGAGACTGTATTTCATGGGTTGGTGATGAAGGAGAATTCAAATTAAACCAGCCAGAATTGGTAGCACAAAAATGGGGACAGCGAAAAAACAAGCCCACCATGAATTATGAAAAACTTAGCCGTGCTTTACGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACC
  5   1   2       add Neu4                            IMAGE:3475728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGTGAAGAGTTCTCTTCCTGTTATACCGAGGGAGTTCACATTTATATCAGGAAGAGAACTCTGCAACCTTAACCAAGAAGATTTCTTCCAGAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCTTTTTTTGCTTNTTCGGAAATATGTTTTGGCGAGTCAGGAACAGGGAGGCGAAATAcccccccccACCATTGATCACCCTGTACAGATTATACCAGCATTAATCCAGCCCTCAGCGCAAACAACCATTAAAGTAATAAACAGTCAAACCAAAGTAGCAAAAATACAAAGGGCGCCACGCATTTCTGGGGAAGACAGAAGTTCACCAGGAAACAGAACAGGGAACAATGGGCAGATACAGTTATGGCAGTCTCTCTTAGAATCGCTCACTGACAAAGACGCTAGAGACTGTATTCTATGGGTTGGCGACCAAAGAGAATTAAAACTGAACCCGCCAGAACTGGTGGGCCATAAATGGGGA
  5   1   2      skin Ga12                                 XL151l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTGAACTCCCTCGGTATAACAGGAAGAGAACTCTGCAACCTTAGCCAGAAGACTTCTTCCAAAGAGTCCCCAGAGGAGAAATTTTGTGGAGTCATTTGGAGCTTCTTAGGAAATATGTTTTGGCGAGCCAGGAACAGGGAGGCGAAATTGCAACAGTTACCATTGATCAGACTGTGCATATTATACCAGCATCAATCCAACCAACCGCACAAACAACCATTAAAGTAATAAATAGTCAAACCAAAGTAGCAAAAATACAAAGGACGCCGCGCATTTCTGGGGAAGACCGAAGTTCACCAGGAAACAGAACAGGGAACAATGGGCAGATCCAGCTATGGCAGTTTCTTCTAGAATTGCTCACTGACAAAGACGCTAGAGACTGTATTTCATGGGTTGGTGATGAAGGAGAATTCAAATTAAACCAGCCAGAATTGGTAGCACAAAAATGGGGACAGCGAAAAAACAAGCCCACCATGAATTATGAAAAACTTAGCCGTGCTTTACGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACCCTAATTGGCTACAGCGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCGAAGATGCAATTACACAGCATTGGGCAGCCTATGACAGCAGTCACACTGGCTAC
  5   1   1       add Neu7      out                        XL024l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGCTGttttttcttccttgttttgtgacaaaaagtcatgggatttcccttccTGGTTCGGCCGAATCCAAATCCTGCTGAAAAAGGCCTCCCTAGTTATTATTTGTAATAATAATTTTATTCTATAATTGGTAATTGTAGATTACAGTTAAGCGCGCACACAGAGGGGTTGGAGGGTCCTAAAGTTCCACTATGAAGAACAAAACTATTGTATTTGTTTTTGTTTTCCGTGTAGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACCCTAATTGGCTACAGCGCAGCAGAACTGAGTCGGTTGGTGGCAGAATGTGAACAAAAGAAAATGGCGAAGATGCAATTACACAGCATTGGGCAGCCTATGACAGCAGTCACACTGGCTACCGCTTCTCTTCAAAAATAATAATTGGGCTCTGCAGGAACTCAAACTGATACTTTCCATCTGTGCATTGGTCCTCCTTTATTGGATTCTGATGCCTTTTTATTTGCAGACCTCACACTAAAAGGCATGATTATTTTGGGGGGGttttttttttGA
  3   1   2       add Ga15      in                       XL448i12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGATGAAGGAGAATTCAAATTAAACCAGCCAGAANTGGTAGCACAAAAANGGGGACAGCGNAAAAACAAGCCCNCCATGAATTANGANAAACNTAGCCGTGCNTTNCGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATCTCAAGACCCTAATTGGCTACAGCGCAGCAGAACTGAGTCGGCTGGNGGCAGAATGTGAACAAAAGAAAATGGCGAAGATGCAATTACACAGCATTGGGCAGCCTATGACAGCAGTCNCNCTGGNTNCCGCTTCTCTTCAAAAATAATAATTGGGCTNTGCAGGAACTCAAACTGATACTTTCCATNTGNGCATTGGTCCTCCTTTATTGGATTNTGATGCCTTTTTATTTGCAGACCTCACNCTAAAAGGCATGATTATTTTGGGGGTTTTTTTTTTGAAAGAGACTTGGACTTCATTACACTTGGATCTTGTAACATTTGTTTACAGTTACCTTTGTTCATGAAGCATGGCTTATATTCAACATGAACTTAATGAGCTCAACTCTTTCTAATGAGCTTAAGCCTTCTCCACAAAAATC
  3   1   2       bld Ga12      in                         XL172b04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAAACTTAGCCGTGCTTTACGGTATTACTATGACGGTGACATGATCTGTAAAGTTCAAGGAAAGAGGTTTGTTTATAAGTTTGTTTGTGATNTCAAGACCCTAATTGGCTACAGC
  3   1   0       add Ga12 5g3  in                         XL182i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNCTGGNTNCCGNTTTTTTTCAAAAATAATAATTGGGCTTTGCAGGAACTCAAACTGATNCTTTCCATNTGNGCNNTGGTCCTCCTTTATTGGATTTTGANGCCTTTTTATTTGCAGNCCTCNCNCTAAAAGGCATGATTNTTTTGGGGGTTTTTTTTTTTGAAAGAGACTTGGACTTCATTACACTTGGATCTTGTAACATTTGTTTACAGTTACCTTTGTTCATGAAGCATGGCTTATATTCAACATGAACTTAATGAGCTCAACTCTTTCTAATGAGCTTAAGCCTTCTCCACAAAAATCATCTTCATTATAAAGCC

In case of problems mail me! (