Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk71c17ex.3                         18 END     2          25       11                (no blast hit)
     2   1.5    0Xl3.1-IMAGE:4743578-IMAGp.5                 5 END     2          25       40                hypothetical protein LOC431059 [Gallus gallus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6957983.5                       4 PI      98        769      924                (no blast hit)
     4   0.0    0Xl3.1-XL022d02.5                            2 PI      88          1      924                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012781512 Xl3.1-XL039a23.5 - 8 ESTs
                                                                       .-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL039a23.5                                                                                                                                                        CCTGGCAATGTCTGCAGAAGTCACGGCACTCCATGGCTGCAGTGTATAACTCTGCTGTGTATAACCGCACATCTCCAGCACTCCAAAGATACCCGCTACCTTGTTGGAGTCATCTTCAACCGCAGCTGCTAAAAAAAATACCCCCACACTGACTTCAGTTTGCCCTCTCCGCCCCTCTCACTGCCTTACCTCTTGCTCCAAACACCGACTTTGCCACTGTGCTGGGGCAGCTTGAAATTCCACAAGGGGCAGCAGCTGAAGGAAACTTGGAGAGCCCTGTATTGTTATACACAGCGGTCCATTCACTCACGGAATTCATATAATGGTTTAAATCCCAATTTGTATGCGCGGTACAGCAAGGGGCTGTAACCGTACATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTTCCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGTGGTGAAACGCTCACTTACAAAATGCTGGGTTACATACAGACTATGGATTCAGCCGTATACAGGTCAGCGCAGCATTATATGAACCCTTCACCGAGAGATATATTCAGGGTCTATGCTAGATGGAGACTTTCTACCCTCCTCTTCATCCTCACAGCGGAGATAAAGTCAAAGTGACACCGTCCAGATTCTATCCCGTCCCAGAAATGATCCATGCCATGATCTTTCCAGCTATAGATCAAGTCTGCATGTTCACCCCCCACCCCTGTCAGCCATGGAGTTCTGTATAATGCAGACATTGCCTTTTTTAAGAGAGAAAAAAAAAAACAAGAAATATATATAATATATACATATATATTTATTCTTTTAAATGCGGTATTTTTATTTTAAGGAAAGTGCAGGATGTGATTTCACTTAC
                                                  Xl3.1-CHK-1012698349                                                                                                                                                              AATGTCTGCAGAAGTCACGGCACTCCATGGCTGCAGTGTATAACTCTGCTGTGTATAACCGCACATCTCCAGCACTCCAAAGATACCCGCTACCTTGTTGGAGTCATCTTCAACCGCAGCTGCTAAAAAAAATACCCCCACACTGACTTCAGTTTGCCCTCTCCGCCCCTCTCACTGCCTTACCTCTTGCTCCAAACACCGACTTTGCCACTGTGCTGGGGCAGCTTGAAATTCCACAAGGGGCAGCAGCTGAAGGAAACTTGGAGAGCCCTGTATTGTTATACACAGCGGTCCATTCACTCACGGAATTCATATAATGGTTTAAATCCCAATTTGTATGCGCGGTACAGCAAGGGGCTGTAACCGTACATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTTCCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGTGGTGAAACGCTCACTTACAAAATGCTGGGTTACATACAGACTATGGATTCAGCCGTATACAGGTCAGCGCAGCATTATATGAACCCTTCACCGAGAGATATATTCAGGGTCTATGCTAGATGGAGACTTTCTACCCTCCTCTTCATCCTCACAGCGGAGATAAAGTCAAAGTGACACCGTCCAGATTCTATCCCGTCCCAGAAATGATCCATGCCATGATCTTTCCAGCTATAGATCAAGTCTGCATGTTCACCCCCCACCCCTGTCAGCCATGGAGTTCTGTATAATGCAGACATTGCCTTTTTTAAGAGAGAAAAAAAAAAACAAGAAATATATATAATATATACATATATATTTATTCTTTTAAATGCGGTATTTTTATTTTAAGGAAAGTGCAGGATGTGATTTCACTTACTGAAAT
                                                      consensus depths                                                                                                                                                             3     3     3     3     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     6     6     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     5     3     5     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----C-------
                                                      Xl3.1-XL039a23.5                                                                                                                                                                                                                                                                                         TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------ATG------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------TGA------------------------------ATG---------------------------------------------TAA------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------TAA------------------------TAAATG---------------------------------------------TGA
  3   1   2       bld Ga18 5g3  out                     xlk131h06ex.3p GGCCGGGCANAAGGGTGGAGTGCGANAAGGGAGGGTGGGGAGGGAAAAGGNNTAGCCGCNAGTGGTATATATTGCTGTAGGGTGGGAACCTATCATTANCTGCCTGAGATATAGCTTTAGTATTTNGTAGGCATTCTTNCTAGTCCANNNNCCTGGCAATGTCTGCAGAAGTCNCGGCACTCCATGGCTGCAGTGTATANCTCTGCTGTGTATANCCGCACATCTCCAGCACTCCAAAGATACCCGCTNCCTTGTTGGAGTCATCTTCAACCGCAGCTGCTAAAAAAAATACCCCCACACTGACTTCAGTTTGCCCTCTCCGCCCCTCTCACTGCCTTACCTCTTGCTCCAAACACCGACTTTGCCACTGTGCTGGGGCAGCTTGAAATTCCACAAGGGGCAGCAGCTGAAGGAAACTTGGAGAGCCCTGTATTGTTATACACAGCGGTCCATTCACTCACGGAATTCATATAATGGTTTAAATCCCAATTTGTATGCGCGGTACAGCAAGGGGCTGTAACCGTACATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTTCCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGTGGTGAAACGCTCACTTACAAAATGCTGGGTTACATACAGACTATGGATTCAGCCGTATACAGGTNANNCAGCATTATATGAACCCTTCACCGAGAGATATATTCAGGGTCTATGCTAGATGGAGACTTTCTACCCTCCTCTTCATCCTCACAGCGGAGATAAAGTCAAAGTGACACCGTCCAGATTCTATCCCGTCCCAGAAATGATCCATGCCATGATCTTTCCAGCTATAGATCAAGTCTGCATGTTCNCCCCCCNCCCCTNTCAGCCATGGAGTNCTGTAT
  5   1   2       bld Neu7      in                         XL005d03.5p                                                                                GTGGGAACCTATCATTAACTGCCTGAGNATATAGCTTTAGTATTTGGTAGGCATTCTTCCTAGTCCAGTGCCCCTGGCAATGTCTGCAGAAGTCACGGCACTCCATGGCTGCAGTGTATAACTCTGCTGTGTATAACCGCACATCTCCAGCACTCCAAAGATACCCGCTACCTTGTTGGAGTCATCTTCAACCGCAGCTGCTaaaaaaaaTACCCCCACACTGACTTCAGTTTGCCCTCTCCGCCCCTCTCACTGCCTTACCTCTTGCTCCAAACACCGACTTTGCCACTGTGCTGGGGCAGCTTGAAATTCCACAAGGGGCAGCAGCTGAAGGAAACTTGGAGAGCCCTGTATTGTTATACACAGCGGTCCATTCACTCACGGAATTCATATAATGGTTTAAATCCCAATTTGTATGCGCGGTACAGCAAGGGGCTGTAACCGTACATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTTCCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGTGGTGAAACGCTCACT
  5   1   2       bld Neu7                                 XL016j22.5p                                                                                                                                                     GCCCCTGGCAATGTCTGCAGAAGTCACGGCACTCCATGGCTGCAGNGTATGACTCTGCTGTGTATAACCGCACATCTCCAGCACTCCAAAGATACCCGCTACCTTGTTGGAGTCATCTTCAACCGCAGCTGCTaaaaaaaaTACCCCCACACTGACTTNAGTTTGCCCTNTCCGCCCCTCTCACTGCCTTACCTCTTGCTCCAAACACCGACTTTGCCACTGTGCTGGGGCAGCTTGAAATTCCACAAGGGGCAGCAGCTGAAGGAAACTTGGAGAGCCCTGTATTGNTATACACAGCGGTCCATTCACTCACGGAATTCATATAATGGTTTAAATCCCAATTTGTATGC
  5   1   2      seed Neu7      out                        XL039a23.5p                                                                                                                                                                      GCAGAAGTACGGCACTCCATGGCTGCAGTGTATGACTCTGCTGTGTATAACCGCACATCTCCAGCACTCCAAAGATACCCGCTACCTTGTTGGAGTCATCTTCAACCGCAGCTGCTaaaaaaaaTACCCCCACACTGACTTCAGTTTGCCCTCTCCGCCCCTCTCACTGCCTTACCTCTTGCTCCAAACACCGACTTTGCCACTGTGCTGGGGCAGCTTGAAATTCCACAAGGGGCAGCAGCTGAAGGAAACTTGGAGAGCCCTGTATTGTTATACACAGCGGTCCATTCACTCACGGAATTCATATAATGGTTTAAATCCCAATTTGTATGCGCGGTACAGCAAGGGGCTGTAACCGTACATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTTCCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGCGGTGAAACGCTCACTTACAAAATGCTGGGTTACATACAGACTATGGATTCAGCCGTATACAGGTCAGCGCAGCATTATATGAACCCTTCACCGAGAGATATATTCAGGGTCTATGCTAGATGGAGACTTTCTACCCTCCTCTTCATCCTCACAGCGGAGATAAAGTCAAAGTGACACCGTC
  3   1   2       bld Neu7      in                         XL005d03.3p                                                                                                                                                                                                                                                                                                                                                      CTTGCTCCAAACACCGGACTTTGCCACTGTGCTGGGGCAGCTTGAAATTCCACAAGGGGCAGCAGCTGAAGGAAACTTGGAGAGCCCTGTATTGTTATACACAGCGGTCCATTCACTCACGGAATTCATATAATGGTTTAAATCCCAATTTGTATGCGCGGTACAGCAAGGGGCTGTAACCGTACATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTTCCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGTGGTGAAACGCTCACTTACAAAATGCTGGGTTACATACAGACTATGGATTCAGCCGTATACAGGTCAGCGCAGCATTATATGAACCCTTCACCGAGAGATATATTCAGGGTCTATGCTAGATGGAGACTTTCTACCCTCCTCTTCATCCTCACAGCGGAGATAAAGTCAAAGTGACACCGTCCAGATTCTATCCCGTCCCAGAAATGATCCATGCCATGATCTTTCCAGCTATAGATCAAGTCTGCATGTTCACCCCCCACCCCTGTCAGCCANGAGTTCTGTATAATGCAGA
  5   1   2       bld Int2                            IMAGE:8821132.5p                                                                                                                                                                                                                                                                                                                                                              CGCGGCTGCAGATACAAAGGACCCCCAAAATAATAATTCGTCCCCAAGGGGCAGCAGCTGAAGGAAACTTGGAGAGCCCTGTATTGTTATACACAGCGGTCCATTCACTCACGGAATTCATATAATGGTTTAAATCCCAATTTGTATGCGCGGTACAGCAAGGGGCTGTAACCGTGCATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTACCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGCGGTGAAACGCTCACTTATAAAATGCTGGGTTACATACAGACTATGGATTCAGCCGTATACAGGTCAGCGCAGCATTATATGAACCCTTCACCGAGAGATATATTCAGGGTCTATGCCAGATGGAGACTTTCTACCCTCCTCTTCATCCTCACAGCGGAGATAAAGTCAAAGTGACACCGTCCAGATTCTATCCCGTCCCAGAAATGATCCATGCCATGATCTTTCCAGCTTCAGATCAAGTCTGCATGTTCACCCCCCACCCCTGTCAGCCATGGAGTTCTGTATAATGCAGACATTGCCTTTTTTAAGAGAGaaaaaaaaaaacaagaaatatatataatatatacatatatatTTATTCTTTTAAATGCGGTATTTTTATTTTAAGGAAAGTGCAGGATGTGATTTCACTTACTGAAATAAAGGAACCTTGCACGGCATCGGGTATTTTCGGCACTGTCCTCTCCCACATGTGAAGGGGTTGTATTAGATAGATCTATGTAAATAACATCAATTAAAACCTATCACAGTAATAGCCCGGCCCCACAACTCCAATAATGGTAAAAGAACCTTCA
  3   1   2       bld Em10      out                   IMAGE:7980466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTCACGGATTTCATAATAATGGTTTAAATCCCAATTTGTATGCGCGGTACAGCAAGGGGCTGTAACCGTACATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTTCCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGTGGTGAAACGCTCACTTACAAAATGCTGGGTTACATACAGACTATGGATTCAGCCGTATACAGGTCAGCGCAGCATTATATGAACCCTTCACCGAGAGATATATTCAGGGTCTATGCTAGATGGAGACTTTCTACCCTCCTCTTCATCCTCACAGCGGAGATAAAGTCAAAGTGACACCGTCCAGATTCTATCCCGTCCCAGAAATGATCCATGCCATGATCTTTCCAGCTATAGATCAAGTCTGCATGTTCACCCCCCACCCCTGTCAGCCATGGAGTTCTGTATAATGCAGACATTGCCTTTTTTAAGAGAGAAAAAAAAAAACAAGAAATATATATAATATATACATATATATTTATTCTTTTAAATGCGGTATTTTTATTTTAAGGAAAGTGCAGGATGTGATTTCACTTACTGAAAGAAAAGGAACCTTGCACGGCATCGGGTATTTTCGGCACTGTCCTCTCCCACATGTGAAGGGGTTGTATTAGATAAGATCTATGAAAAAAAAACCCCACCC
  5   1   2       bld Ga18      out                      xlk52j04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTGTATGCGCGGTACAGCAAGGGGNTGTAACCGTACATGGATCCATGCCGCTTCGGAGAAATCCGCTTATTTTTCAGCTCTGGAGAGGTCACTTCTGTCTATGAACTTTGTGACGTCGTCCGACATTGTGATATCATCTGCTTAGCTTAATTTTCTGCCTGTTTATCTGCGGTGAAACGCTCACTTACAAAATGCTGGGTTACATACAGACTATGGATTCAGCCGTATACAGGTCAGNNNCGNNTATATGAACCCTTCACCGAGAGATATATTCAGGGTCTATGCTAGATGGAGACTTTCTACCCTCCTCTTCATCCTCACAGCGGAGATAAAGTCAAAGTGACACCGTCCAGATTCTATCCCGTCCCAGAAATGATCCATGCCATGATCTTTCCAGCTTCAGATCAAGTCTGCATGTTCAcccccccaccccTGTCAGCCATGGAGNTCTGTATAATGCAGACATTGCCTTTTTTAAGNGAGaaaaaaaaaacnagaaatatatatnatatatacatatatatTTATTCTTTTNAATGCNGGNATTTTTATTTTAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)