Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6631670.5                       5 PI      92        273     1031                putative polyA-binding protein PABPN2/ePABP2 [Xenopus laevis]
     2   0.0    0Xl3.1-IMAGE:7205509.5                       4 PI      98        252     1082                embryonic poly(A) binding protein 2 [Xenopus laevis]

 This cluster: approximate FL confidence score = 90%

 1012781736 Xl3.1-IMAGE:6317522.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6317522.5 GTTGTTACAGTTTGGGTATATTTTTCAAACAATCTTTAAGAATTATCTAACCATTAGCACAGATACAGAACCTATACTATATGGAGAAGTTGCTTAAAAAGTTTTGGAAAGAACAGAGTTAATATATAACAAACCTCTGGTCAAGTAGAGATCCCCGTTAGCTCTGGCAAGTAAAGGGTTATTGAAGGACTGGGCCAAAAGTTCTGCTGTGTTTCCTCCTAGGCATTAGCATTTCTGTGGAACAGTCACACCAGGTGTGGATTAAAACAAGGTGTGGGAAAACCACATTATATTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCCGAGGAATGTGAATTGGATGATCCTGAATTGAAGGCCATCAGAATGCGAGTGCGAGAAATGGAAGAGGAGGCAGAGCGTCTGAAGGGGTTATCTGGACAGGATAAGAGTATTGGTGTCAGCACTAGGCCCTGCATGCAAACGACCCATTCAAAGATGACCGCAGGAGCATATACTGAGGGTCCTCCACAGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAACGATCAGTTTATGTTGGCAACGTGGATTACGGAAGTACAGCCCAGGATTTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAATCGCATCACTATTCTATGCGACAAGTTCTCCGGACATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTCGATGCTGCAGTGGCAATGGATGAAACCGTATTTCGAGGACGAACAATCAAGGTCCTACCCAAGAGAACAAACATGCCAGGAATTAGCAGCACGGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGGAACCGAGGGAATTACCAGAGAGGACAAAGGCCCAGAGGAAGGCCTTTCAGAGGTCGCGGAAGACCAGGCCCTTTGAATAACCCATACTNGATGTGAAGAGTCTTTAGCCTACCAACTCTGTGTGCACATCGTATAGCTAACAAGTGGGAAGGAGAGTGGCTTCAACATGCCTTTAATCTGGTGCCCTAGGGATTGCTAAGGTA
                                                  Xl3.1-CHK-1012708544       ACAGTTTGGGTATATTTTTCAAACAATCTTTAAGAATTATCTAACCATTAGCACAGATACAGAACCTATACTATATGGAGAAGTTGCTTAAAAAGTTTTGGAAAGAACAGAGTTAATATATAACAAACCTCTGGTCAAGTAGAGATCCCCGTTAGCTCTGGCAAGTAAAGGGTTATTGAAGGACTGGGCCAAAAGTTCTGCTGTGTTTCCTCCTAGGCATTAGCATTTCTGTGGAACAGTCACACCAGGTGTGGATTAAAACAAGGTGTGGGAAAACCACATTATATTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCCGAGGAATGTGAATTGGATGATCCTGAATTGAAGGCCATCAGAATGCGAGTGCGAGAAATGGAAGAGGAGGCAGAGCGTCTGAAGGGGTTATCTGGACAGGATAAGAGTATTGGTGTCAGCACTAGGCCCTGCATGCAAACGACCCATTCAAAGATGACCGCAGGAGCATATACTGAGGGTCCTCCACAGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAACGATCAGTTTATGTTGGCAACGTGGATTACGGAAGTACAGCCCAGGATTTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAATCGCATCACTATTCTATGCGACAAGTTCTCCGGACATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTCGATGCTGCAGTGGCAATGGATGAAACCGTATTTCGAGGACGAACAATCAAGGTCCTACCCAAGAGAACAAACATGCCAGGAATTAGCAGCACGGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGGAACCGAGGGAATTACCAGAGAGGACAAAGGCCCAGAGGAAGGCCTTTCAGAGGTCGCGGAAGACCAGGCCCTTTGAATAACCCATACTNGATGTGAAGAGTCTTTAGCCTACCAACTCTGTGTGCACATCGTATAGCTAACAAGTGGGAAGGAGAGTGGCTTCAACATGCCTTTAATCTGGTGCCCTAGGGATTGCT
                                                      consensus depths      1     1     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     3     2     3     2     3     2     3     1     3     1     3     1     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH MIN     307      89 
                                               BLH MPR      43      89 
                                               BLH OVR     322     344 
                                               ORF LNG     322      12 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ==== 2e-012     NP_001027768.1 glycine rich RNA binding protein [Ciona intestinalis] ================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 9e-044     NP_492504.1 poly binding protein II like (22.6 kD) (1J998) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 1e-046     NP_724648.1 CG2163-PB [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 6e-047     XP_313998.3 AGAP005117-PA [Anopheles gambiae str. PEST] ---------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 5e-047     XP_799120.1 PREDICTED: similar to polyadenylate-binding protein nuclear 1 [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 3e-054     XP_001232211.1 PREDICTED: similar to Pabpn1-prov protein [Gallus gallus] ----------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PROTEIN --- Bt ---- 1e-056     NP_776994.1 poly(A) binding protein, nuclear 1 [Bos taurus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 8e-057     NP_001098602.1 hypothetical protein LOC794679 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PROTEIN --- Cf ---- 1e-057     NP_001123909.1 poly(A) binding protein, nuclear 1 [Canis lupus familiaris] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN --- Mm ---- 1e-057     NP_062275.1 poly(A) binding protein, nuclear 1; poly(A) binding protein II [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PROTEIN --- Hs ---- 8e-058     NP_004634.1 poly(A)-binding protein, nuclear 1; poly(A) binding protein II; oculopharyngealmuscular dystrophy; poly(A) binding protein 2 [Homo sapiens] ---------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 1e-120     AAI21547.1 Poly(A) binding protein, nuclear 1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 4e-125     NP_001084418.1 embryonic poly(A) binding protein 2 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6317522.5                                                                                               TAA------------------------------------------------TAG------------------------------------------------------------------------------TAG---------------------------------TAA---------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATGTGA------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2       bld Te2N 5g                         IMAGE:7204691.5p GTTGTTACAGTTTGGGTATATTTTTCAAACAATCTTTAAGAATTATCTAACCATTAGCACAGATACATAACCTATACTATATGGAGAAGTTGCTTAAAAAGTTTTGGAAAGAACAGAGTTAATATATAACAAACCTCTGGTCAAGTAGAGATCCCCGTTAGCTCTGGCAAGTAAAGGGTTATTGAAGGACTGGGCCAAAAGTTCTGCTGTGTTTCCTCCTAGGCATTAGCATTTCTGTGGAACAGTCACACCAGGTGTGGATTAAAACAAGGTGTGGGAAAACCACATTATATTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCCGAGGAATGTGAATTGGATGATCCTGAATTGAAGGCCATCAGAATGCGAGTGCGAGAAATGGAAGAGGAGGCAGAGCGTCTGAAGGGGTTATCTGGACAGGATAAGAGTATTGGTGTCAGCACTAGGCCCTGCATGCAAACGACCCATTCAAAGATGACCGCAGGAGCATATACTGAGGGTCCTCCACAGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAACGATCAGTTTATGTTGGCAACGTGGATTACGGAAGTACAGCCCAGGATTTAGAGGCTCACTTCAGTAGCTGTGGTTCCCATCATCGCATCACTATTCTATGCGACAAGTTCTCCGGACATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTCCATGCTGCAGTGGCAATGGATGAAACCGTATTTCGAGGACAACAATCAAGGTCCTACCCAGAAGACAAACTTGCCCAGGATTAACAGCCAGGGAACGGGGGGTGGGGTCCGCTGGCCAAACCCTCCAGGAAAAC
  5   1   2      seed Te2N 5g                         IMAGE:7201839.5p           TTTGGGTATATTTTTCAAACAATCTTTAAGAATTATCTAACCATTAGCACAGATACAGAACCTATACTATATGGAGAAGTTGCTTAAAAAGTTTTGGAAAGAACAGAGTTAATATATAACAAACCTCTGGTCAAGTAGAGATCCCCGTTAGCTCTGGCAAGTAAAGGGTTATTGAAGGACTGGGCCAAAAGTTCTGCTGTGTTTCCTCCTAGGCATTAGCATTTCTGTGGAACAGTCACACCAGGTGTGGATTAAAACAAGGTGTGGGAAAACCACATTATATTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCCGAGGAATGTGAATTGGATGATCCTGAATTGAAGGCCATCAGAATGCGAGTGCGAGAAATGGAAGAGGAGGCAGAGCGTCTGAAGGGGTTATCTGGACAGGATAAGAGTATTGGTGTCAGCACTAGGCCCTGCATGCAAACGACCCATTCAAAGATGACCGCAGGAGCATATACTGAGGGTCCTCCACAGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAACGATCAGTTTATGTTGGCAACGTGGATTACGGAAGTACAGCCCAGGATTTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAATCGCATCACTATTCTATGCGACAAGTTCTCCGGACATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTCGATGCTGCAGTGGCAATGGATGAAACCGTATTTCGAGGACGAACNNATCAGGTCCTACCCAAGAGGACAAACATGCCAGGAATTAGCAGCACCGGACAGGGGGTGGGGGTTCGGTTGGCAAAACTCCAAGGA
  5   1   2       bld Egg1 5g                            PBX0103H05.5p                             ACAATCTTTAAGAATTATCTAACCATTAGCACAGATACAGAACCTATACTATATGGAGAAGTTGCTTAAAAAGTTTTGGAAAGAACAGAGTTAATATATAACAAACCTCTGGTCAAGTAGAGATCCCCGTTAGCTCTGGCAAGTAAAGGGTTATTGAAGGACTGGGCCAAAAGTTCTGCTGTGTTTCCTCCTAGGCATTAGCATTTCTGTGGAACAGTCACACCAGGTGTGGATTAAAACAAGGTGTGGGAAAACCACATTATATTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATCGAGCCGAGGAATGTGAATTGGATGATCCTGAATTGAAGGCCATCAGAATGCGAGTGCGAGAAATGGAAGAGGAGGCAGAGCGTCTGAAGGGGTTATCTGGACAGGATAAGAGTATTGGTGTCAGCACTAGGCCCTGCATGCAAACGACCCATTCAAAGATGACCGCAGGAGCATATACTGAGGGTCCTCCACAGCCTCTGAGTGCAG
  5   1   2       bld Ov1  5x3                        IMAGE:6317522.5p                                                                                                                                                                                                                                                   AGTCACACCAGGTGTGGATTAAAACAAGGTGTGGGGAAAACCACATTATATTGCCTTCTCTGTGGGATGAAACGTGGGTGATGTCTGAGAGAGTTTCAGAAGAACCGGGACTGGACAAAGGGGATGGAGCCGAGGAATGTGAATTGGATGATCCTGAATTGAAGGCCATCAGAATGCGAGTGCGAGAAATGGAAGAGGAGGCAGAGCGTCTGAAGGGGTTATCTGGACAGGATAAGAGTATTGGTGTCAGCACTAGGCCCTGCATGCAAACGACCCATTCAAAGATGACCGCAGGAGCATATACTGAGGGTCCTCCACAGCCTCTGAGTGCAGAGGAGAAGAAAGAAATTGACAAACGATCAGTTTATGTTGGCAACGTGGATTACGGAAGTACAGCCCAGGATTTAGAGGCTCACTTCAGTAGCTGTGGTTCCATCAATCGCATCACTATTCTATGCGACAAGTTCTCCGGACATCCAAAAGGATATGCATATATTGAGTTTGCAGAAAGGAACTCTGTCGATGCTGCAGTGGCAATGGATGAAACCGTATTTCGAGGACGAACAATCAAGGTCCTACCCAAGAGAACAAACATGCCAGGAATTAGCAGCACGGACAGGGGTGGGTTCCGTGGCAGACCTCGAGGGAACCGAGGGAATTACCAGAGAGGACAAAGGCCCAGAGGAAGGCCTTTCAGAGGTCGCGGAAGACCAGGCCCTTTGAATAACCCATACTNGATGTGAAGAGTCTTTAGCCTACCAACTCTGTGTGCACATCGTATAGCTAACAAGTGGGAAGGAGAGTGGCTTCAACATGCCTTTAATCTGGTGCCCTAGGGATTGCTAAGGTATGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)