Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7009404.5                       9 END     5          83       55                MGC81920 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL170c12.3                           10 PI      88         13      520                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012781777 Xl3.1-xlk78f20ex.3 - 6 ESTs
                                                                       -470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk78f20ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TACGAGCAGGTGATGAGAGCGATGCAGAAACGTGGACAGAATGTGGAGCAGGTGCTGGAGTATCTCTTCATCCAGGCACGGCTCTGTGAGAAGGGATTTTATCCGGCCCTGGTGGAAGAAGCAATGGAAATGTATCAGTGGTCTGAGGAGAAGACGACGGAATTCCTCCAGTTAATGAGCAAGTTCAAAGAAATGGGGTTTGATCAGAAGGACATTAAAGAGGTTCTCCTGTTGCACAATAATGACCAGGACAAAGCCCTGGAGGAGTTAATGACTCGGGCCGGAGCCAGATGAATCCCCTCGGGCAGAACATTTGACATAAGGATATGAGCAACGCTGTTGGATATTTACCTGGAAACCAGGTGTCTCTGAGCAAATCCACAAGCCCTGACTATTGAGGAACATGAGATACATAAACCCCTCCCAATGAAGCTCCAGCTGGAAAATACATGGAAGAAGAGCCCTTTTGTCCCCAAACCCGTCAGGCGGGGCAGAGAGAGGGGGTTCATTTTCGGAACGTAATATGCACGACACAAGGTGCGGCGTCTCCTGTTTTGCTTTGCAGTGGATCATAGGAAACCACAAGCTGGAAGCCTCGAGGGCCTATTGAGTGAAGCTGCTTTTTGTGCCGGAACACTGGCTGTTGTGATGGGGCGGCCTTTAGTGCAATCGATTTGTATTCTTCTTTAGGTATTAGTGCAACACTGGTTATTAAAGTTATAGAGTCAAACAACTCTACCCTCCTCTTCATTTGCTTCCCAATACCCTGTTACTCAACAGTGGGGGGAGGGGGACTTTTGTGGAGCCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCACTACATTATTCCCCTTTATTTAAGGAGATATCCAAATAAATATGTATA
                                                  Xl3.1-CHK-1012703010                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------------------------CGTGGACAGAATGTGGAGCAGGTGCTGGAGTATCTCTTCATCCAGGCACGGCTCTGTGAGAAGGGATTTTATCCGGCCCTGGTGGAAGAAGCAATGGAAATGTATCAGTGGTCTGAGGAGAAGACGACGGAATTCCTCCAGTTAATGAGCAAGTTCAAAGAAATGGGGTTTGATCAGAAGGACATTAAAGAGGTTCTCCTGTTGCACAATAATGACCAGGACAAAGCCCTGGAGGAGTTAATGACTCGGGCCGGAGCCAGATGAATCCCCTCGGGCAGAACATTTGACATAAGGATATGAGCAACGCTGTTGGATATTTACCTGGAAACCAGGTGTCTCTGAGCAAATCCACAAGCCCTGACTATTGAGGAACATGAGATACATAAACCCCTCCCAATGAAGCTCCAGCTGGAAAATACATGGAAGAAGAGCCCTTTTGTCCCCAAACCCGTCAGGCGGGGCAGAGAGAGGGGGTTCATTTTCGGAACGTAATATGCACGACACAAGGTGCGGCGTCTCCTGTTTTGCTTTGCAGTGGATCATAGGAAACCACAAGCTGGAAGCCTCGAGGGCCTATTGAGTGAAGCTGCTTTTTGTGCCGGAACACTGGCTGTTGTGATGGGGCGGCCTTTAGTGCAATCGATTTGTATTCTTCTTTAGGTATTAGTGCAACACTGGTTATTAAAGTTATAGAGTCAAACAACTCTACCCTCCTCTTCATTTGCTTCCCAATACCCTGTTACTCAACAGTGGGGGGAGGGGGACTTTTGTGGAGCCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCACTACATTATTCCCCTTTATTTAAGGAGATATCCAAATAAATATGTATATCGGCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            2     2     2     2     2     3     2     3     2     3     2     3     1     3     2     3     3     3     3     3     3     4     3     4     3     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     3     3
  5   1   2       bld Brn3                            IMAGE:8537391.5p TCGCCCCTATCGGCACAGTCAGCAATATCAAGTCCCTCTTCTTCCCCAAATTAGACTGTGACGAGGGGGAGCAGAACAGAGCAAAATTCACAAGCACTTTTCATAGCACTTCTTGTCTACCCAACAGCACCTTCCTTGATTCCTTATCCGCTGGTTCTCCCCATAAACCCAGTGAAATCAATGGACACCATATGCCAGGCCTATCTTCTTCACAAGCTGACATTTTGGCACAAACTGCCATGTCTCCTCCCTCAGCCACACAAATACTTCCAATGGGCACTGTAGAAAAAGCAAGGACGTCTCCAAATACTGATGCCAAGATAACAACTCCGCATGTGACTGTATTAAAGGTGCCCAACAGCATGGCCTGCAGCGAGCGTGGGGGGGCGCCATCTTATGAGGAGCTGCTGCGGGCGCTTTCCAGCAGTGAGAGACAGTGTGTAGAGACCATTGTGGGTATGGGATACTCGTACGAGCAGGTGATGAGAGCGATGCAGAAACGTGGACAGAATGTGGAGCAGGTGCTGGAGTATCTCTTCATCCAGGCACGGCTCTGTGAGAAGGGATTTTATCCGGCCCTGGTGGAAGAGCAATGGAATGTATCAGTGGTCTGAAGAAAGACGAGGAATTCTCCAGTAATGACAAGTCAAAGAAATGGGTTGATAGAGGACTTAAGAGTCTCTGTTGAAAATGACAGACAGCCTGAGATTAGATCGGCCGACAAGATCCCCGCAAATTTACANGTTACACTGTGATTCCGACAGGCTACATCCACTAATGAAAAAATACTCAGACCCGAAAAGAAACTCCACTTGGT
  3   1   2      seed Ga18 5g3  out                      xlk78f20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                       AGNAGTGANAGACANNNNGTAGAGNCCATNGNGGGTATNGGATANTCGTACGAGCAGGTGATGAGANCGATGNAGAAACGTGGACAGAATGTGGAGCAGGTGCTGGANTATCTCTTCANCNANNNACGGCTCTGTGAGAAGGGNTTTTATCCGGCCCTGGTGGAAGAAGCAATGGAANTGTATCAGTGGTCTGAGGAGAAGACGACGGAATTCCTCCAGTTAATGAGCAAGTTCAAAGAAATGGGGTTTGATCAGAAGGACATTAAAGAGGTTCTCCTGTTGCACAATAATGACCAGGACAAAGCCCTGGAGGAGTTAATGACTCGGNCCGGAGCCAGATGAATCCCCTCGGGCAGAACATTTGACATAAGGATATGAGCAACGCTGTTGGATATTTACCTGGAAACCAGGTGTCTCTGAGCAAATCCACAAGCCCTGACTATTGAGGAACATGAGATACATAAACCCCTCCCAATGAAGCTCCAGCTGGAAAATACATGGAAGAAGAGCCCTTTTGTCCCCAAACCCGTCAGGCGGGGCAGAGAGAGGGGGTTCATTTTCGGAACGTAATATGCACGACACAAGGTGCGGCGTCTCCTGTTTTGCTTTGCAGTGGATCATAGGAAACCACAAGCTGGAAGCCTCGAGGGCCTATTGAGTGAAGCTGCTTTTTGTGCCGGAACACTGGCTGTTGTGATGGGGCGGCCTTTAGTGCAATCGATTTGTATTCTTCTTTAGGTATTAGTGCAACACTGGTTATTAAAGTTATAGAGTCAAACAACTCTACCCTCCTCTTCATTTGCTTCCCAATACCCTGTTACTCAACAGTGGGGGGAGGGGGACTTTTGTGGAGCCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCACTACATTATTCCCCTTTATTTAAGGAGATATCCAAATAAATATGTATATCGCCNNNNNNTGAA
  3   1   2       bld Ga18      out                     xlk111h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGNAGAAACGNGGNNNNAATGTGGANNAGNNGCTNNAGTNTCTCNTCANNNANNCACGGCTCTGTGAGNAGGATTTTANCCGGCCCTGGTGGAAGAAGCAATGGAAATGTATCAGTGGTCTGAGGAGAAGNCGACGNAATTCCNCCAGTTAATGAGCAAGTTCAAAGAAATGGGGTTTGATCAGAAGGACATTAAAGAGGTTCTCCTGTTGCACAATAATGACCAGGACAAAGCCCTGGAGGAGTTAATGACTCGNNCCGGAGCCAGATGAATCCCCTCGGGCAGAACATTTGACATAAGGATATGAGCAACGCTGTTGGATATTTACCTGGAANCCAGGTGTCTCTGAGCAAATCCACAAGCCCTGACTATTGAGGAACATGAGATACATAAACCCCTCCCAATGAAGCTCCAGCTGGAAAATACATGGAAGAAGAGCCCTTTTGTCCCCAAACCCGTCAGGCGGGGCAGAGAGAGGGGGTTCATTTTCGGAACGTAATATGCACGACACAAGGTGCGGCGTCTCCTGTTTTNCTTTGCAGTGGATCATAGGAAACCACAAGCTGGAANCCTCGAGGGCCTATTGAGTGAAGCTGCTTTTTGTGCCGGAACACTGGCTGTTGTGATGGGGCGGCCTTTAGTGCAATCGATTTGTATTCTTCTTTAGGTATTAGTGCAACACTGGTTATTAAAGTTATAGAGTCAAACAACTCTACCCTCCTCTTCATTTGCTTCCCAATACCCTGTTACTCAACAGTGGGGGGAGGGGGACTTTTGTGGAGCCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCACTACATTNTTCCCCTTTATTTAAGGAGNNNNNCAAA
  3   1   2       bld Ga12 5g3  out                        XL168n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAGAAGCAATGGAAATGTATCAGTGGTCTGAGGAGAAGACGACGGAATTCCTCCAGTTAATGAGCAAGTTCAAAGAAATGGGGTTTGATCAGAAGGACATTAAAGAGGTTCTCCTGTTGCACAATAATGACCAGGACAAAGCCCTGGAGGAGTTAATGACTCGGGCCGGAGCCAGATGAATCCCCTCGGGCAGAACATTTGACATAAGGATATGAGCAACGCTGTTGGATATTTACCTGGAAACCAGGTGTCTCTGAGCAAATCCACAAGCCCTGACTATTGAGGAACATGAGATACATAAACCCCTCCCAATGAAGCTCCAGCTGGAAAATACATGGAAGAAGTGCCCTTTTGTCCCCAAACCCGTCAGGCAGGGCAGAGAGAGGGGGTTCATTTTCGGAACGTAATATGCACGACACAAGGTGCGGCGTCTCCTGTTTTGCTTTGCAGTGGATAATAGGAAACCACAAGCTGGAAGCCTCGAGGGCCTATTGAGTGAAGCTGCTTTTTGTGCCGGAACACTGGCTGTTGTGATGGGGCGGCCTTTAGTGCAATCGATTTGTATTCTTCTTTAGGTATTAGTGCGACACTGGTTATTAAAGTTATAGAGTCAAACAACTCTACCCTCCTCTTCATTTGCTTCCCAATACCCTGTTACTCAACAGTGGGGGGAGGGGGACTTTTGTGGAGCCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCACTACATTATTCCCCTTTATTTAAGGAGATATCCAAATAAATA
  3   1   2       bld Ov1  5g3  out                   IMAGE:5073274.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCCAATGAAGCTCCAGCTGGAAAATACATGGAAGAAGAGCCCTTTTGTCCCCAAACCCGTCAGGCGGGGCAGAGAGAGGGGGTTCATTTTCGGAACGTAATATGCACGACACAAGGTGCGGCGTCTCCTGTTTTGCTTTGCAGTGGATCATAGGAAACCACAAGCTGGAAGCCTCGAGGGCCTATTGAGTGAAGCTGCTTTTTGTGCCGGAACACTGGCTGTTGTGATGGGGCGGCCTTTAGTGCAATCGATTTGTATTCTTCTTTAGGTATTAGTGCAACACTGGTTATTAAAGTTATAGAGTCAAACAACTCTACCCTCCTCTTCATGTGCTTCCCAATACCCTGTTACTCAACAGTGGGGGGAGGGGGACTTTTGTGGAGCCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCACTACATTATTCCCCTTTATTTAAGGAGATATCCAAATAAATATGTATATCGGCCTTTTGCCTGAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga12      out                        XL152g07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTGCAGTGGATAATAGGAAACCACAAGCTGGAAGCCTCGAGGGCCTATTGAGTGAAGCTGCTTTTTGTGCCGGAACACTGGCTGTTGTGATGGGGCGGCCTTTAGTGCAATCGATTTGTATTCTTCTTTAGGTATTAGTGCGACACTGGTTATTAAAGTTATAGAGTCAAACAACTCTACCCTCCTCTTCATTTGCTTCCCAATACCCTGTTACTCAACAGTGGGGGGAGGGGGACTTTTGTGGAGCCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCACTACATTATTCCCCTTTATTTAAGGAGATATCCAAATAAATATGTATATCAGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)