Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3199584.3                       2 END     2          22      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL477f10ex.5                         62 PI      82        392      661                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012781787 Xl3.1-IMAGE:3199584-IMAGp.5 - 9 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3199584-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGGGGATTTGCTCCTGCGCCCCTTCCCCTTTACTCATCACAATGTCTTCTCCCAGGAAGATCAAAGAGGATTTAAGTTCTGATGAAGAGGGCCAAGTGCACCCCACGCTCTCCCCTTCTGAGGATCACAAGATCAAGATCTCCCCTTTCAGCGTGGAAGCGCTCATGGCTGATAAGAGGAAGAGGGTTCCTAAGGAGACTCCCCTCTTACGTGCAGTGGACTCGTCTCCAGCCAGTAGCACCCCCAGCAGTCATATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACAAAAACCTTTGAAACCTCATCGGTGAAATCAGAAAACTCTGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCTGCTATTCCCCTCCACCAAGACACCTGAGCCCATCTACCTGCCCTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTACTGGCCCTGGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAAGCCAAAAGACTCCAGGAAGCGGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCTGGCTTTAGTATACCTTTCCCCATCAACTCTCCTATTCAGGCTGCATCATTGTATGGATCATCTTATCAATTT
                                                  Xl3.1-CHK-1012697455                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTGCTCCTGCGCCCCTTxxCxxTTACTCATCACAATGTCTTCTCCCAGGAAGATCAAAGAGGATTTAAGTTCTGATGAAGAGGGCCAAGTGCACCCCACGCTCTCCCCTTCTGAGGATCACAAGATCAAGATCTCCxxxxTxAGCGTGGAAGCGCTCATGGCTGATAAGAGGxxxxxxGTTCCTAAGGAGACTCCCCTCTTAxxxGxxxxGxxxTCGTCTCCAGCCAGTAGCACCCCCAGCAGTCATATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACAAAAACCTTTGAAACCTCATCGGTGAAATCAGAAAACTCTGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCTGCTATTCCCCTCCACCAAGACACCTGAGCCCATCTACCTGCCCTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTTACCACCTCCCAGTTACTGGCCCTTGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAAGCCAAAAGACTCCAGGAAGCGGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCTGGCTTTAGTATACCTTTCCCCATCAACTCTCCTATTCAGGCTGCATCATTGTATGGATCATCTTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 2     4     2     5     3     5     3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     8     8     8     8     7     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     7     8     8     8     8     8     8     8     8     8     7     7     6     7     3     4     2     3     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGACTGCCTTTCAGCGTGGAAGCGCTCATGGCTGAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----C-----G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----C--T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Ce ==== 2e-032     NP_509648.1 msh homeodomain protein, Variable ABnormal morphology VAB-15 (25.2 kD) (vab-15)[Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ag ---- 6e-035     XP_313452.3 AGAP003669-PA [Anopheles gambiae str. PEST] ---------========================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 8e-036     NP_477324.1 Drop CG1897-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 4e-037     NP_001093604.1 transcription factor protein [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sp ---- 7e-044     NP_999778.1 homeodomain protein [Strongylocentrotus purpuratus] -------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 8e-052     NP_571351.2 muscle segment homeobox D [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Cf ==== 3e-079     NP_001003098.1 muscle segmentation homologue (MSX2) [Canis familiaris] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 6e-080     NP_002440.2 msh homeo box homolog 2 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Mm ==== 2e-081     XP_001475936.1 PREDICTED: similar to homeobox protein [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Bt ==== 1e-082     NP_001073082.1 msh homeobox 2 [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 3e-090     NP_989890.1 homeobox-containing Hox-8 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 3e-113     P35993 Homeobox protein XHOX-7.1' [Xenopus laevis]  =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 1e-121     AAH64202.1 LOC394987 protein [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:3199584-IMAGp.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2       bld Ga15                               XL502o05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCACTGATGACTGGCAGTCTGCAACTACTACTACTGCTGCTGCTACTACAGTGCGACAAGAAGGGGATTTGCTCCTGCGCCCCTTTACTCACCGCAATGTCTTCTCCCAGGAGGATCAAAGAGGATTTAAACTCGGATGAAGAGGGCCAAGTGCACCCTACGCTCTCCCCATCTGAGGATCACAAGATCAAGATCTCCAGCCTCCCTTTCAGCGTGGAAGCGCTCATGGCTGATAAGAGGGTTCCTAAAGAGGCTCCCCCCTCACGTGCTGTGGACTCGTCTGCCGCCACCAGCACCCCTAACCGGCACCTTCATTTAGGGATCAGGGACAGCCCGAGCCCCCCTGGGCTCACAAAAACCTTTGAAACCTCGTCGGTCAAATCGGAAAACTCCGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCAGCTATTCCCCTCCGCCAAGACACCTGAGCCCATCCTCTTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTACTGGCCCTTGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAAGCCAAAAGACTCCAGGAAGCGGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCTGGCTTTAGTATACCTTTTCCCCATCAACTCTCCTATTCAGGCTGCATCATT
  5   1   2       bld Ga15                               XL503o05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCACTGTGCTGGCAGTCTGCAACTACTACTACTGCTGCTGCTACTACAGCTGCGACAAGAAGGGGATTTGCTCCTGCGCCCCTTTACTCACCGCAATGTCTTCTCCCAGGAGGATCAAAGAGGATTTAAACTCGGATGAAGAGGGCCAAGTGCACCCTACGCTCTCCCCATCTGAGGATCACAAGATCAAGATCTCCAGCCTCCCTTTCAGCGTGGAAGCGCTCATGGCTGATAAGAGGGTTCCTAAAGAGGCTCCCCCCTCACGTGCTGTGGACTCGTCTGCCGCCACCAGCACCCCTAACCGGCACCTTCATTTAGGGATCAGGGACAGCCCGAGCCCCCCTGGGCTCACAAAAACCTTTGAAACCTCGTCGGTCAAATCGGAAAACTCCGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCAGCTATTCCCCTCCGCCAAGACACCTGAGCCCATCCTCTTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTACTGGCCCTTGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAAGCCAAAAGACTCCAGGAAGCGGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCTGGCTTTAGTATACCTTTCCCCATCAACTCTCCTATTCAGGCTGCATCATTGTATGGATCATCTTATCAATTTCACA
  5   1   2       bld Egg5                   IMAGE:3431088-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTGGTAGGGACTGCTCTTGCTTGCTCCCCTTTACTCATCACAATGTCTTCTCCCAGGAAGATCAAAGAGGATTTAAGTTCTGATGAAGAGGGCCAAGTGCACCCCACGCTCTCCCCTTCTGAGGATCACAAGATCAAGATCTCCAGACTGCCTTTCAGCGTGGAAGCGCTCATGGCTGATAAGAGGGTTCCTAAGGAGACTCCCCTCTTACGTGCAGTGGACTCGTCTCCAGCCAGTAGCACCCCCAGCAGTCATATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACAAAAACCTTTGAAACCTCATCGGTGAAATCAGAAAACTCTGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCTGCTATTCCCCTCCACCAAGACACCTGAGCCCATCTACCTGCCCTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTTACCACCTCCCAGTTACTGGCCCTGGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAGAACAGAAGAGCCAAAGCCAAAAGACTTCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCTGGCTTTAGTATACCTTTCCCTATCAACTCT
  5   1   2      seed Tbd2                   IMAGE:3199584-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTGGTAGGGACTGCTCTTGCGGCTCCCCTTTACTCATCACAATGTCTTCTCCCAGGAAGATCAAAGAGGATTTAAGTTCTGATGAAGAGGGCCAAGTGCACCCCACGCTCTCCCCTTCTGAGGATCACAAGATCAAGATCTCCAGACTGCCTTTCAGCGTGGAAGCGCTCATGGCTGATAAGAGGGTTCCTAAGGAGACTCCCCTCTTACGTGCAGTGGACTCGTCTCCAGCCAGTAGCACCCCCAGCAGTCATATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACAAAAACCTTTGAAACCTCATCGGTGAAATCAGAAAACTCTGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCTGCTATTCCCCTCCACCAAGACACCTGAGCCCATCTACCTGCCCTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTTACCACCTCCCAGTTACTGGCCCTGGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAGAACAGAAGAGCCAAAGCCAAAAGACTTCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCTGGCTTTAGTATACCTTTCCCTATCAACTCTCCTATTCAG
  5   1   2       bld Tbd2      out                   IMAGE:3199584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGGTAGGGACTGCTCTTGCGGCTCCCCTTTACTCATCACAATGTCTTCTCCCAGGAAGATCAAAGAGGATTTAAGTTCTGATGAAGAGGGCCAAGTGCACCCCACGCTCTCCCCTTCTGAGGATCACAAGATCAAGATCTCCAGACTGCCTTTCAGCGTGGAAGCGCTCATGGCTGATAAGAGGGTTCCTAAGGAGACTCCCCTCTTACGTGCAGTGGACTCGTCTCCAGCCAGTAGCACCCCCAGCAGTCATATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACAAAAACCTTTGAAACCTCATCGGTGAAATCAGAAAACTCTGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCTGCTATTCCCCTCCACCAAGACACCTGAGCCCATCTACCTGCCCTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTTACCACCTCCCAGTTACTGGCCCTGGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAGAACAGAAGAGCCAAAGCCAAAAGACTTCAGGAAGCAGAAATAGAAAAGCTTGAAATGGCAGCAAAGCCCATACTACCTNCTGGCTNTAGTATACCTTTCCCTATCAAACTC
  5   1   2       bld Neu7      out                        XL023g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTAAGTTCTGATGAAGAGGGACAAGTGCACCCCACGCTCTCCCCTTCTGAGGATCACAAGNATCAAGATCTCCAGNACTGCCTTTCAGCGTGGAAGCGCTCATGGCTGATAAGAGGGTTCCTAAGGAGACTCCCCTCTTACGTGCAGTGGACTCGTCTCCAGCCAGTAGCACCCCCAGCAGTCACCTTAATATGGGGATCAGGGACAGCCCAAGTCCCCCTGGGCTCACAAAAACCTTTGAAACCTCATCGGTGAAATCAGAAAACTCTGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCTGCTATTCCCCTCCACCAAGACACCTGAGCCCATCTACCTGCCCTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCGCTTTACCACCTCCCAGTTACTGGCCCTGGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAG
  5   1   2       bld Emb1                            IMAGE:5155540.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACGCGTGGGCAAAAACCTTTGAAACCTCGTCGGTCAAATCGGAAAACTCCGAAGATGGCACCAGCTGGTCCAAAGACGGGGGCAGCTATTCCCCTCCGCCAAGACACCTGAGCCCATCCTCTTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTACTGGCCCTTGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAAGCCAAAAGACTCCAGGAAGCGGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCTGGCTTTAGTATACCTTTCCCCATCAACTCTCCTATTCAGGCTGCATCATTGTATGGATCATCTTATCAATTTCACAGGCCAGTTCTTCCAATCCCACCCATGGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCCTGAGGAGGGTGACATGACATAGGAAAGGAAAAGAGTACTGGGAACATGTTCATAGACTCAAAGCGTCTCAAGACCGCCCATCATAAAGAATGGGAGAGCCCAGCCTCTCTTTTTACAGGGTGCCCTCTGGATCAAACTGCACCCTTCCTCCAAATACTTTAATTGCAGCAGTTCCTTCATGCAACTGCAAAAGACTGCATTGAACAGGTACCAAAAATCATAGAGAAAGCCCGTGTAATGGNTGGATTTCTTCTCCGCCATTAACTCCCTTAACTTTAGGGACTATGTTCAGGCCTAGTATTACATATCAGCCCTGTACTGAAATGTATGAGCC
  5   1   2       bld Ga15                               XL408b05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CNCATCCTCTTGCACTTTGAGGAAACACAAAACCANCAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTACTGGCCCTTGAGCGCAAGTTCCGCCAGAAGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAAGCCAAAAGACTCCANGAAGCGGAAATAGAAAAGCTGAAAATGGCANCAAAGCCCATACTACCTCCTGGGCTTTA
  5   1   2      skin Ga12                                 XL179e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCCTTGAGCGCAAGTTCCGCCAGAGGCAATATCTCTCCATAGCAGAAAGAGCAGAATTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAAGCCAAAAGACTCCAGGAAGCGGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCTGGCTTTAGTATACCTTTCCCCATCAACTCTC

In case of problems mail me! (