Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8738990.5                      27 PI      80          1      791                (no blast hit)

 This cluster: approximate FL confidence score = 58%

 1012782006 Xl3.1-IMAGE:8735798.3 - 10 ESTs
                                                                       ....-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8735798.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCACTTCTCTGGCTTTTGTCCTGCATTGCCCTTATTGGAAGCACTTATGGCTGTGGTAGCCCAGCCATCAATCCAGTACTTTCTGGATATGCTAGGATTGTGAACGGTGAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTCTCTGCAGGACAGCACCGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCTCTGGGTTGTCACTGCTGCACATTGTGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCCCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTATCCAGCCCTGCTTCCTTCAGGAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCATAGATGCGTTCAATGGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTAAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCTTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGAGTATATGCTCGTGTCTCAACTCTTAGATCCTGGATGGATCAGATAATTGCTGCCAATTAAATACATCTATCTGTACTTAAACATCTGTATTAAATGATATTTAATTAAAA
                                                  Xl3.1-CHK-1012696231                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTCTGGCTTTTGTCCTGCATTGCCCTTATTGGAAGCACTTATGGCTGTGGTAGCCCAGCCATCAATCCAGTACTTTCTGGATATGCTAGGATTGTGAACGGTGAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTCTCTGCAGGACAGCACCGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCTCTGGGTTGTCACTGCTGCACATTGTGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCCCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTATCCAGCCCTGCTTCCTTCAGGAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCATAGATGCGTTCAATGGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTAAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCTTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGAGTATATGCTCGTGTCTCAACTCTTAGATCCTGGATGGATCAGATAATTGCTGCCAATTAAATACATCTATCTGTAxxTAAACATCTGTATTAAATGATATTTAATTAAAATAAACT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  3     8     3     8     3     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     6     8     6     8     6     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     9    10     9    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     7    10     7    10     7    10     7    10     6    10     6    10     6    10     6    10     6    10     6    10     4    10     4     9     4     9     2     7     2     5     2     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T--C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T-------
                                               BLH ATG       1     100                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
  3   1   2       add Tad1                            IMAGE:6878671.3p AAAGGAGCGCAGTACATATACGCACACAGGTCGTAGTTCTTATTTCACAGCGCCACATGTAAACGCGTCAGGCACGTGGGCTAACTGTTTCCTTGAGCCTGACACAATAATAGAGGCGGTCCTCCTCCAATGTCGGCACTATCATATCCATCCTTCGCGAGCGCCCCTACCTCATTATATATCCGGCCGCGGCGGCAGAATAATATATACCCCCGGGTATATAAAACAATACAGGGAAATAGTTCAAAACAAAGCAGTTTAGGTGGGGGACAAGAATAGATAGGGGCGGTCAAAATACTCTCCGCCCGACGGGCTACACTAGTTCTGCCTAATCATCTCACCACTATACAGCCCCGCGCGGCGTTAAGGGGAGGGGGGGATCATCAAATATGCTACGGGAAAGGGGGGCAATTCACTTTTCGTAGGGGACACGCCGGGGGTGTTGTAAAATAAAAATAAAGACCGGCCCCCCGAGGGATCAAACCCCGCACATCACTCGGACTGCAGCGCAACTTTAAAAAACCCCCGCGTGTAAGGGGCACCCAAAAAAAATGTGGGGGGTTCAATTAAATAGCGCCATAGAGGGCACTCCGCAGTGCCCGACTTGGGTGTTATTTTACCCCACTCTGTCCCTTATATGAATGGGTCTATTTGTTGAAAAATTCTAACCGTGGCCGCATTGGGGAGGGTATAATCCCAACTGGTTCGCCCGCCATATGGCGGGTAGGTACACCCAACCCTGCGCCGACCGGGGGTTAATTTTCGTGGGGGGAAATATAAATCGGTTCGTGCTCCCAAATAAGGCGGTGGGCGGATCCAAACCAGGGGGCCAAAGATTTTCAGTCGCGCCCAATAACAACTCGTTCGCCGTTGCCAATGATATCGCGCTTCGGAAACTTCCCAGCCGTGGTCCCCTCAGCAACACTGTTTATACTGTCTGCGATGGGGATTCAGTAGATGCGTTCAATAGTGAAGAGAGATGCGTCACAACTGGCTGGGGCTACGCGGATGCTGCCTCCTAGATTACCCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTAAGCAACACTGAATGCCGGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGGTGGTGCTTCTGGTGCCTCTTCTTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGAGTATATGCTCGTGTCTCAACTCTTAGATCCTGGATGGATCAGATAATTGCTGCCAATTAAAGGCATCTATCGGTACTTAACCCCCCTTTTGGAAAAAANNANTCNNCCCCGCGGGGTTCGCGGGCCGGGAAGGGGGGATAGGGGGAAAGGGGAA
  3   1   2       add Tad1      in                    IMAGE:6877619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATTAACAGCCCGGGGTGTCCCCGGTCAGCCAAAGGAGCCCGTGGCAAGTTTTCATGGTTTTTTGTCCCGGCATGTGCCCCTTATTGGGAAGACCCGTAAAGGCTATTGGTAGCCCCGCCCATCAATTCCCATTCTTTTATGGGATATGCTTGGGATTGGGAATGGTGAAAATCCATTACCGGGATCCTGGCCTGGGCAAAATTTCTTGCCAGGCCAGCACTGGTTTCCACTTCTGTGGTGGCTCCTTTGATTAGCGACCTCTGGTTGTTCACTGCTGCACATTGCGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCTCCAGCTGAGTCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTGTCCAGCCCTGCTTCCTTCAGCAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCGTAGATGCGTTCAATAGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTAAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCTTGCATGGGTGACTCTGGTGGACCACTTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGAGTATATGCTCGTGTCTCAACTCTTAGATCCTGGATGGATCAGATAATGCTGCCAATTAAATACATCTATCGGTACTTAAAC
  3   1   2       add Tad1                            IMAGE:6878597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTAATTATGGGGAGGTTATTAGGTAATAATTTTACTTTAAAGAAGGGGGTTAAGTAGAATTTAGAATAAAATGTGTACTAGTTTAAGTGTAACGAGCCAAAAGCAACCATTAAGATGTTTTAAAACTGGTCACAGGTAAATGTTTCCTGCTGCTTGGCTGATATATATATTAAATTAATTAGACCTGTAGCAAACATTAAAGCTTTTATTACGTGATCCCCTCCATATCCGTTGGATTTTATTTTGATTAAAGAGATTTTACATTACATCTGTTTATCCCTTCAGAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCTCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTGTCCAGCCCTGCTTCCTTCAGCAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCGTAGATGCGTTCAATAGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTAAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCTTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGAGTATATGCTCGTGTCTCAACTCTTAGATCCTGGATGGATCAGATAATGCTGCCAATTAAATCATCTTCTGTAATAACGATACTATTCATGGC
  3   1   2       bld Tad1                            IMAGE:6879371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCGCCGCAAAAGGAACCCAGGCCACTTATTCTGGCTTTTGTTCTTGCATTCCCCTTATGGGAAGCCACTTAAGGGCTGTGGTAGCCCCAGCCATCAATCCCAGTATTTTCTGGATAGGCTAGGATTGTAACGGGGAAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTTCTCTGCAGGACAGCACCGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCCTCTGGGTTGTCACTGCTGCACATTGTGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATTGATCGTTCTTCCCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTATCCAGCCCTGCTTCCTTCAGGAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCATAGATGCGTTCAATGGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTTAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCCTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGCGTTTACGCTCGTGTCTCATCTCTTAGATCCTGGATGGATCAGACAATGCTGCCAATAAA
  5   1   2       add Tad1      in                    IMAGE:6877619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGACACAGCAGCAAAGAACCATGGCACTTCTCTGGCTTTTGTCCTGCATTGCCCTTATTGGGAGCACGTATGGCTGTGGTAGCCCAGCCATCAATCCAATACTTTCTGGATATGCTAGGATTGTGAATGGTGAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTCTCTGCAGGACAGCACTGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCTCTGGGTTGTCACTGCTGCACATTGCGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCTCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCNATGATATCACACTTCTGAAACTGTCCAGCCCCTGCTTCCTTCAGCAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCGTAGATGCGTTCAATAGTGGCGAGAGATGCCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCAAACCAGCTGCAACATGTAACTCTGCCTCTTCTTAACCACACTGAATGCCCGAAAAAATTGGGGGAAACAAGAATTCCTAACCACAatgggtcctgggctgggggctttcctgggggcccctttccggcaatggggggaactcctggcgggaaacacctttgggtccaaaaaaaaaTGGAAACCTTGGGGGTGCCGGGCCTGGGAAAATTAGGTCCCCGGGGGGGAAAAGTTTCTAACAATGGCTCTTCCCCAATTCATTCATCCTCGGGAAGATAAAAAAACGTCTCCAGGGGCTCCCCAAA
  3   1   2      seed Panc      in                    IMAGE:8735798.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGATCATCGATCGATCGTCCGACCATGCACTCTCTGCTTTGTCTGCATGCCTTATGGAAGCACTTATGGCTGTGGTAGCCCAGCCATCAATCCAGTACTTTCTGGATATGCTAGGATTGTGAACGGTGAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTCTCTGCAGGACAGCACCGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCTCTGGGTTGTCACTGCTGCACATTGTGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCCCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTATCCAGCCCTGCTTCCTTCAGGAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCATAGATGCGTTCAATGGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTTAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCCTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGCGTTTACGCTCGTGTCTCATCTCTTAGATCCTGGATGGATCAGACAATTGCTGCCAATTAAATACATCTATCTGTATCTAAACATCCGTATTTACT
  5   1   2       add Panc                            IMAGE:8736889.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAACCATGGCACTTCTCTGGCTTTTGTCCTGCATTGCCCTTATTGGAAGCACTTATGGCTGTGGTAGCCCAGCCATCAATCCAGTACTTTCTGGATATGCTAGGATTGTGAACGGTGAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTCTCTGCAGGACAGCACCGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCTCTGGGTTGTCACTGCTGCACATTGTGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCCCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTATCCAGCCCTGCTTCCTTCAGGAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCATAGATGCGTTCAATGGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGTAGCTCTGCCTCTTCTTAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCCTGCATGGGTGACTCTGGTGACCACTTGTGTGCCAAAGAAATGAGCTGGGTGCTGCTGAATTGTGTCCTGGGGAGTCTACATGCTCTCATCATCTCTGCGTTTACGCTCGTGTCTCATTCTCTTAGATCTGATTGATCAAACATGCTGCAATAATACATCTATCTGTATCTACTCGTCATAATGGATATTAGTACTCTAGCCACCCATTATTTATTCAGCACAAACGAC
  5   1   2       bld Panc      in                    IMAGE:8735798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCATGGCACTTCTCTGGCTTTTGTCCTGCATTGCCCTTATTGGAAGCACTTATGGCTGTGGTAGCCCAGCCATCAATCCAGTACTTTCTGGATATGCTAGGATTGTGAACGGTGAAAATGCAGTACCTGGATCCTGGCCTTGGCAAATTTCTCTGCAGGACAGCACCGGTTTCCACTTCTGTGGTGGCTCTTTGATTAGCGACCTCTGGGTTGTCACTGCTGCACATTGTGGTGTCACAACCTCCCACCGTGTTATTCTTGGTGAATATGATCGTTCTTCCCCAGCTGAGCCTATCCAGACCAAAACAATTGCCAAGGTTTTCAGACACCCCAGTTACAACTCGTTCACCATTGCCAATGATATCACACTTCTGAAACTATCCAGCCCTGCTTCCTTCAGGAACACTGTTTCTACTGTCTGCGTTGCTGCTTCCATAGATGCGTTCAATGGTGGCGAGAGATGCGTCACAACTGGCTGGGGCTACGTGGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTTAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCCTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGGATTGTGTCCTGGGGAGTTCTACATGCTCTCCATCATCTCCTGGCGTTTACGCTCGTGTCTCATCTCTTAGATCCTGGATGGATCAGACATGCTGCCATTAAATACATCTATCTGTATTCTAACATTCTGTTATTAAATGATATTCGTAAATAACTCTAAGCAACTCACAAAAAAATATATGGGCGGCCGCCAGGCCCTGAATA
  5   1   2       add Tad1                            IMAGE:6881220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATGCTGCCTCTAGATTAACCCCAAACAAGCTGCAGCAGGTAGCTCTGCCTCTTCTAAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCTTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGAGTATATGCTCGTGTCTCAACTCTTAGATCCTGGATGGATCAGATAATTGCTGCCAATTAAATACATCTATCTGTACTTAAACATCTGTATTAAATGATATTTAATTAAAATAAACTTATAGCCAACTCATTTCATGCNNNNNANAANNaaaaaaaaaaaaaaaaaaaaNAACCTTGAC
  5   1   2       bld Panc                            IMAGE:8734468.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTCTAGATTAACCCCAAACAAGCTGCAGCAGGCAGCTCTGCCTCTTCTTAGCAACACTGAATGCCAGAGATATTGGGGAAGCAAGATCCTAAGCACAATGGTCTGTGCTGGTGCTTCTGGTGCCTCTTCCTGCATGGGTGACTCTGGTGGACCACTTGTGTGCCAAAGAAATGGAGCTTGGGTGCTGGCTGGAATTGTGTCCTGGGGAAGTTCTACATGCTCTCCATCATCTCCTGGCGTTTACGCTCGTGTCTCATCTCTTAGATCCTGGATGGATCAGACAATTGCTGCCAATTAAATACATCTATCTGTATCTAAACATCTGTATTAAATGATATTTAATTAAAATAAACTCATAGCCAACTCAttttattttttttttaaaaaaaaaaaaaaaaaaaaaaGAGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)