Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL427g01ex.3                         11 END     6          54       54                (no blast hit)
     2   2.0    0Xl3.1-XL036l01.3                            9 END     2          18       22                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL419e07ex.5                          6 PI      89          1      511                paired-box 3 [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012782028 Xl3.1-XL437p02ex.5 - 11 ESTs
                                                                       ......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL437p02ex.5                                                                                                                               CCCGTCACACAGTGTCACTAGTTACCCTCCGAGGCAGGACGAGGCTCCGCTGTCTTCTCTGGTGGCACCGGCTCTCACTCTCTCTCTCTATACAGGGCCACTTGGATTTAATACTTGGCAAGGGAACTGAGAATGACCAGCTTGGCTGGAGCTGTGCCAAGAATGATGAGACCATGCCCAGGACAGAACTATCCCCGGACTGGCTTCCCTCTGGAAGTGTCCACTCCCTTAGGCCAAGGCAGGGTGAACCAGCTGGGTGGAGTGTTTATCAATGGCAGGCCCCTGCCCAACCACATCAGGCACAAGATAGTGGAGATGGCACACCATGGCGTCCGACCCTGCGTCATCTCCCGTCAGCTCAGGGTGTCGCACGGCTGCGTCTCCAAAATCCTGTGCAGATACCAGGAGACCGGATCCATCAGACCTGGAGCCATCGGGGGCAGCAAACCCAAGCAGGTGACAACTCCAGAAGTGGAGAAAAAGATGGAAGAATTTAAAAGAGACAACCCGGTAAGCTCCATCAGCCGAATTTTGAGGAGCAAATTTGGGAAAGGGGATGAGGAGGACATGGAGCTGGATCGGAAGGAGCAGGAGGAGAGTGAGAAGAGAGCAAAGCATAGCATTGATGGGATCCTAAGGGAAAGAGCTCCAGTGTCCCCTGAGTCTGAGGAAGGCTCTGATATTGACTCCGAACCAGACCTGCCCCTGAAGAGGAAGCAGCGCAGGAGCAGAACCACATTCACTGCAGAGCAGTTGGAGGAGTTAGAGAGAGCATTCGAGAGAACCCACTACCCGGATATTTACACTCGGGAAGAACTGGCCCAGAGAGCCAAGCTCACAGAGGCGCGAGTTCAGGTGTGGTTTAGCAACCGACGCGCTAGATGGAGAAAGCAAGCAGGAGCCAACCAGCTTATGGCATTCAACCACCTGATTCCAGGGGCATTTCCTCCTGCAGCTATGCCAGCTCTGCCAACCTACCAGTTATCAGAGACCTCTTACCAGCCCACTTCTATACCACAAGCTGTGTCTGATCCAAGCAACACAGTTCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCCGAGAGCAGTTCGGCCTATTGTCTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGAACCCAGCCATTGGCAATGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGCGTTCCACATCAGCCTCAGACGGATTATGCTTTATCTCCTTTAACTGGAGGCCTTGAGCCTTCCACAGCTGTATCAGCAAGTTGCAGCCAGAGACTGGAACATATGAAGAGCTTGGACAGTCTATCAACATCGCAGTCTTATTGCCCAACGTACAGCACCTCAGGCTACAGCATGGAGCCTGTCACAGGATACCAATACCCACAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGTGGTCCCTCTTGTGCTATAACACTCAGAATGGATACACAT
                                                  Xl3.1-CHK-1012694533                                                                                                                                     ACACAGTGTCACTAGTTACCCTCCGAGGCAGGACGAGGCTCCGCTGTCTTCTCTGGTGGCACCGGCTCTCACTCTCTCTCTCTATACAGGGCCACTTGGATTTAATACTTGGCAAGGGAACTGAGAATGACCAGCTTGGCTGGAGCTGTGCCAAGAATGATGAGACCATGCCCAGGACAGAACTATCCCCGGACTGGCTTCCCTCTGGAAGTGTCCACTCCCTTAGGCCAAGGCAGGGTGAACCAGCTGGGTGGAGTGTTTATCAATGGCAGGCCCCTGCCCAACCACATCAGGCACAAGATAGTGGAGATGGCACACCATGGCGTCCGACCCTGCGTCATCTCCCGTCAGCTCAGGGTGTCGCACGGCTGCGTCTCCAAAATCCTGTGCAGATACCAGGAGACCGGATCCATCAGACCTGGAGCCATCGGGGGCAGCAAACCCAAGCAGGTGACAACTCCAGAAGTGGAGAAAAAGATGGAAGAATTTAAAAGAGACAACCCGGTAAGCTCCATCAGCCGAATTTTGAGGAGCAAATTTGGGAAAGGGGATGAGGAGGACATGGAGCTGGATCGGAAGGAGCAGGAGGAGAGTGAGAAGAGAGCAAAGCATAGCATTGATGGGATCCTAAGGGAAAGAGCTCCAGTGTCCCCTGAGTCTGAGGAAGGCTCTGATATTGACTCCGAACCAGACCTGCCCCTGAAGAGGAAGCAGCGCAGGAGCAGAACCACATTCACTGCAGAGCAGTTGGAGGAGTTAGAGAGAGCATTCGAGAGAACCCACTACCCGGATATTTACACTCGGGAAGAACTGGCCCAGAGAGCCAAGCTCACAGAGGCGCGAGTTCAGGTGTGGTTTAGCAACCGACGCGCTAGATGGAGAAAGCAAGCAGGAGCCAACCAGCTTATGGCATTCAACCACCTGATTCCAGGGGCATTTCCTCCTGCAGCTATGCCAGCTCTGCCAACCTACCAGTTATCAGAGACCTCTTACCAGCCCACTTCTATACCACAAGCTGTGTCTGATCCAAGCAACACAGTTCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCCGAGAGCAGTTCGGCCTATTGTCTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGAACCCAGCCATTGGCAATGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGCGTTCCACATCAGCCTCAGACGGATTATGCTTTATCTCCTTTAACTGGAGGCCTTGAGCCTTCCACAGCTGTATCAGCAAGTTGCAGCCAGAGACTGGAACATATGAAGAGCTTGGACAGTCTATCAACATCGCAGTCTTATTGCCCAACGTACAGCACCTCAGGCTACAGCATGGAGCCTGTCACAGGATACCAATACCCACAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGTGGTCCCTCTTGTGCTATAACACTCAGAATGGAT
                                                      consensus depths                                                                                                                                    2     4     2     5     2     5     2     5     2     5     4     5     3     5     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     4     5     4     5     4     5     5     6     4     5     5     5     5     5     5     5     5     5     4     5     4     5     5     6     5     6     5     6     5     6     4     5     4     5     3     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG     132    1671                                                                                                                               
                                               BLH MIN     132     311                                                                                                                               
                                               BLH MPR     129     311                                                                                                                               
                                               BLH OVR     132     770                                                                                                                               
                                               CDS MIN     132     311                                                                                                                               
                                               ORF LNG     132      67                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 4e-034     XP_001190953.1 PREDICTED: similar to paired box transcription factor pax1/9 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ==== 6e-053     NP_001024570.1 Variable ABnormal morphology family member (vab-3) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 6e-057     BAE06639.1 transcription factor protein [Ciona intestinalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 7e-074     NP_523863.1 CG3388-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ag ---- 5e-076     XP_559100.2 AGAP010358-PA [Anopheles gambiae str. PEST] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PREDICTED = Bt ==== 0          XP_616352.3 PREDICTED: similar to PAX7 transcriptional factor isoform 1 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PREDICTED = ?? ==== 0          XP_877025.3 PREDICTED: paired box 3 isoform 7, partial [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 0          NP_571352.1 paired box gene 3 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Cf ---- 0          XP_545664.2 PREDICTED: similar to paired box gene 3 isoform PAX3d [Canis familiaris] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 0          NP_032807.2 paired box gene 3 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 0          NP_989600.1 paired box gene 3 (Waardenburg syndrome 1) [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 0          NP_852124.1 paired box gene 3 isoform PAX3e; paired box homeotic gene 3; paired domain gene3; paired domain gene HuP2; PAX3/FKHR fusion gene [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          CAJ82363.1 paired box protein 3 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAV31937.1 paired-box 3 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL437p02ex.5                                                                                                                                                 TAG---------------------------------------------------------------------------------------TAA---------------------ATG---------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------TAA---------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   0       chi Tbd7      out                        XL094n17.5p GCTGGTCCTTGGGTCGCACTTGAGCATCTTTCTTGCTTCTCCTGCTGACCACGCAGAAGGTTTCTCATACCAACTTGTGAGGACTCTTCTAGGCTCCCTTTGTTGATCCAAACAGAACCTTCTCCTGGTTTAAGAGTTGGAGGCAGCACAGACTGAGGAAGGCAGTTTCTTTGTGATTTGCCCCCTCCTTCTTTGGGTTTTGTTGAGTTGCACCAAGAGTAGGTGTCTTGTTCTTCTTCTACTGCCCAGTTGGGTGTGATGGCTGCTCTGCCCGGTACCATACCAAGGATGATGCGACCTGCCCCAGGACAGAACTATCCTCGCACAGGATTCCCTTTGGAAGTATCTACCCCCCTTGGACAGGGGCGAGTGAACCAGCTGGGAGGGGTATTTATTAATGGCAGGCCCCTGCCCAACCACATTCGTCATAAGATCGTGGAGATGGCCCATCATGGGATCCGACCCTGCGTCATTTCCCGCCAGCTAAGAGTTTCCCACGGGTGTGTGTCCAAAATCCTGTGCAGGTACCAGGAGACTGGATCCATCCGGCCTGGGGCCATCGGGGGCAGCAAACCCAGGGTGGCCACCCCTGATGTGGAGAAGAAGATTGAGGAATACAAGCGGGAAAACCCCGGAATGTTCAGTTGGGAGATTC
  5   1   2       bld Ga15 5g3  out                      XL437p02ex.5p                                                                   GCACTTCACTCTCAGCAAACAGTCAGAAACTCTCTGGGTCCCCACGGGCCCCCGACAATTCCCGTCACACAGTGTCACTAGTTACCCTCCGAGGCAGGACGAGGCTCCGCTGTCTTCTCTGGTGGCACCGGctctcactctctctctctATACAGGGCCACTTGGATTTAATACTTGGCAAGGGAACTGAGAATGACCAGCTTGGCTGGAGCTGTGCCAAGAATGATGAGACCATGCCCAGGACAGAACTATCCCCGGACTGGCTTCCCTCTGGAAGTGTCCACTCCCTTAGGCCAAGGCAGGGTGAACCAGCTGGGTGGAGTGTTTATCAATGGCAGGCCCCTGCCCAACCACATCAGGCACAAGATAGTGGAGATGGCACACCATGGCGTCCGACCCTGCGTCATCTCCCGTCAGCTCAGGGTGTCGCACGGCTGCGTCTCCAAAATCCTGTGCAGATACCAGGAGACCGGATCCATCAGACCTGGAGCCATCGGGGGCAGCAAACCCAAGCAGGTGACAACTCCAGAAGTGGAGAAAAAGATGGAAGAATTTAAAAGAGACAACCCGGTAAGCTCCATCAGCCGAATTTTGAGGAGCAAATttgggaaaggggatgaggaggacatggagctggatcggaaggagcaggaggagagTGAGAAGAGAGCAAAGCATAGCATTGATGGGATCCTAAGGGAAAGAGCTCCAGTGTCCCCTGAGTCTGAGGAAGGCTCTGATATTGACTCCGAAC
  5   1   2       bld Em10 5g3  out                   IMAGE:7981250.5p                                                                                               TGCTCAGGGTCCCCACGCCCTCTCAGACAATTCCCGTCACACAGTGTCACTAGTTACCCTCCCATGCAGGACGAGGCTCCGCTGTCTTCTCTGGTGGCACCGGctctcactctctctctctATACAGGGCCACTTGGATTTAATACTTGGCAAGGGAACTGAGAATGACCAGCTTGGCTGGAGCTGTGCCAAGAATGATGAGACCATGCCCAGGACAGAACTATCCCCGGACTGGCTTCCCTCTGGAAGTGTCCACTCCCTTAGGCCAAGGCAGGGTGAACCAGCTGGGTGGAGTGTTTATCAATGGCAGGCCCCTGCCCAACCACATCAGGCACAAGATAGTGGAGATGGCACACCATGGCGTCCGACCCTGCGTCATCTCCCGTCAGCTCAAGGTGTCGCACGGCTGCGTCTCCAAAATCCTGTGCAGATACCAGGAGACCGGATCCATCAGACCTGGAGCCATCGGGGGCAGCAAACCCAAGCAGGTGACAACTCCAGAAGTGGAGAAAAAGATGGAAGAATTTAAAAGAGACAACCCGGTAAGCTCCATCAGCCGAATTTTGAGGAGCAAATCTGGGACAGGGGATGAGGAGGACATGGAGCTGGATCCGAAGGAGCAAGACGAGAATGAGAAGAAAACATACATATCATTGATGGGATCCTAAAGGAAAAGCTCAGTGTCCCTGATTCGAGGAGGCCTGATATGACCCGAACAAACTTCCCTGAAAAGAAGCTCCGGGGCAAACCCATCACTCAAACATTGG
  5   1   2       bld Tbd7      out                        XL065b24.5p                                                                                                                         CAATTCCCGTCACACAGTGTCACTAGTTACCCTCCGAGGCAGGACGAGGCTCCGCTGTCTTCTCTGGGTGGCACCGGctctcactctctctctctATACAGGGCCACTTGGATTTAATACTTGGCAAGGGAACTGAGAATGACCAGCTTGGCTGGAGCTGTGCCAAGAATGATGAGACCATGCCCAGGACAGAACTATCCCCGGACTGGCTTCCCTCTGGAAGTGTCCACTCCCTTAGGCCAAGGCAGGGTGAACCAGCTGGGTGGAGTGTTTATCAATGGCAGGCCCCTGCCCAACCACATCAGGCACAAGATAGTGGAGATGGCACACCATGGCGTCCGACCCTGCGTCATCTCCCGTCAGCTCAGGGTGTCGCACGGCTGCGTCTCCAAAATCCTGTGCAGATACCAGGAGACCGGATCCATCAGACCTGGAGCCATCGGGGGCAGCAAACCCAAGCAGGTGACAACTCCAGAAGTGGAGAAAAAGATGGAAGAATTTAAAAGAGACAACCCGGGTATGTTCAGCTGGGAAATTCGCGATAAATTACTTAAAGACGGAGTTTGTGATCGCAATACTGTGCCTTCAGTAAGCTCCATCAGCCGAATTTTGAGG
  5   1   2      skin Tbd7      out                        XL090l10.5p                                                                                                                           CCCCACGGGCCCCCGACAATTCCCGTCACACAGTGTCACTAGTTACCCTCCGAGGCAGGACGAGGCTCCGCTGTCTTCTCTGGGTGGCACCGGctctcactctctctctctATACAGGGCCACTTGGATTTAATACTTGGCAAGGGAACTGAGAATGACCAGCTTGGCTGGAGCTGTGCCAAGAATGATGAGACCATGCCCAGGACAGAACTATCCCCGGACTGGCTTCCCTCTGGAAGGCCAAGGCAGGGTGAACCAGCTGGGTGGAGTGTTTATCAATGGCAGGCCCCTGCCCAACCACATCAGGCACAAGATAGTGGAGATGGCACACCATGGCGTCCGACCCTGCGTCATCTCCCGTCAGCTCAGGGTGTCGCACGGCTGCGTCTCCAAAATCCTGTGCAGATACCAGGAGACCGGATCCATCAGACCTGGAGCCATCGGGGGCAGCAAACCCAAGGTGACAACTCCAGAAGTGGAGAAAAAGATGGAAGAATTTAAAAGAGACAACCCGGTAAGCTCCATCAGCCGAATTTTGAGGAGCAAATTTGGGAAAGGggatgaggaggacatggagctggatcggaaggagcaggaggagagtgagaagagagC
  5   1   2      seed Neu7 5g3  out                        XL036f16.5p                                                                                                                                           AATTCGGTACGAGGGTGAATTCTGCAGATGAACAATCTCTTTTCAAAGGATGGCAGCGACCCCTGATAGACCGGGATTCCTAGGGCCACTTGGATTTAATACTTGGCAAGGGAACTGAGAATGACCAGCTTGGCTGGAGCTGTGCCAAGAATGATGAGACCATGCCCAGGACAGAACTATCCCCGGACTGGCTTCCCTCTGGAAGTGTCCACTCCCTTAGGCCAAGGCAGGGTGAACCAGCTGGGTGGAGTGTTTATCAATGGCAGGCCCCTGCCCAACCACATCAGGCACAAGATAGTGGAGATGGCACACCATGGCGTCCGACCCTGCGTCATCTCCCGTCAGCTCAGGGTGTCGCACGGCTGCGTCTCCAAAATCCTGTGCAGATACCAGGAGACCGGATCCATCAGACCTGGAGCCATCGGGGGCAGCAAACCCAAGCAGGTGACAACTCCAGAAGTGGAGAAAAAGATGGAAGAATTTAAAAGAGACAACCCGGTAAGCTCCATCAGCCGAATTTTGAGGAGCAAATTTGGGAAAGGGGATGAGGAGGACATGGAGCTGGATC
  5   1   2       bld Tbd7                                 XL054n24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCAGCCGAATTTTGAGGAGCAAATttgggaaaggggatgaggaggacatggagctggatcggaaggagcaggaggagagTGAGAAGAGAGCAAAGCATAGCATTGATGGGATCCTAAGGGAAAGAGCTCCAGTGTCCCCTGAGTCTGAGGAAGGCTCTGATATTGACTCCGAACCAGACCTGCCCCTGAAGAGGAAGCAGCGCAGGAGCAGAACCACATTCACTGCAGAGCAGTTGGAGGAGTTAGAGAGAGCATTCGAGAGAACCCACTACCCGGATATTTACACTCGGGAAGAACTGGCCCAGAGAGCCAAGCTCACAGAGGCGCGAGTTCAGGTGTGGTTTAGCAACCGACGCGCTAGATGGAGAAAGCAAGCAGGAGCCAACCAGCTTATGGCATTCAACCACCTGATTCCAGGGGCATTTCCTCCTGCAGCTATGCCAGCTCTGCCAACCTACCAGTTATCAGAGACCTCTTACCAGCCCACTTCTATACCACAAGCTGTGTCTGATCCAAGCAACACAGTTCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCCGAGAGCAGTTCGGCCTATTGTCTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTC
  5   1   2       bld Neu7      out                        XL049a17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAACTGGNAAGAGTTAGAGAGAGCATTCGAGNAGAACCCACTACCCGGATATTTATACACGAGAAGAACTGGCCCAGAGAGCCAAGCTCACAGAGGCGCGAGTTCAGGTGTGGTTTAGTAACCGACGCGCTAGATGGAGAAAGCAAGCAGGAGCCAACCAGCTCATGGCATTCAACCACTTGATCCCAGGGGCTTTTCCTCCTACAGCTATGCCAGCTCTGCCAACCTACCAGTTATCTGAGACCTCTTACCAGCCCACTTCTATACCACAAGCTGTGTCTGATCCAAGCAACACAGTTCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGTCTTCCTTCCAACCCCGACAGCAGTTCGGCCTATTGCCTGCCCAGCGGCCGACATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGAACCCAGCCATTGGCAACGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGGGTTCCTCATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTTGAGCCTCCCACAGCTGTATCAGCAAGTTGCAGCCAGAGACTGGAACATATGAAGAGC
  5   1   2      skin Em10      out                   IMAGE:7981500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCCCAGAGAGCCAAGCTCACAGAGGCGCGAGTTCAGGTGTGGTTTAGCAACCGACGCGCTAGATGGAGAAAGCAAGCAGGAGCCAACCAGCTTATGGCATTCAACCACCTGATTCCAGGGGCATTTCCTCCTGCAGCTATGCCAGCTCTGCCAACCTACCAGTTATCAGAGACCTCTTACCAGCCCACTTCTATACCACAAGCTGTGTCTGATCCAAGCAACACAGTTCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCCGAGAGCAGTTCGGCCTATTGTCTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGAACCCAGCCATTGGCAATGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGCGTTCCACATCAGCCTCAGACGGATTATGCTTTATCTCCTTTAACTGGAGGCCTTGAGCCTTCCACAGCTGTATCAGCAAGTTGCAGCCAGAGACTGGAACATATGAAGAGCTTGGACAGTCTATCAACATCGCAGTCTTATTGCCCAACGTACAGCACCTCAGGCTACAGCATGGAGCCTGTCACAGGATACCAATACCCACAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGTGGTCCCTCTTGTGCTATAACACTCAGAATGGATACACATCAT
  5   1   2       bld Em10                            IMAGE:8321862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCCCAGAGAGCCAAGCTCACAGAGGCGCGAGTTCAGGTGTGGTTTAGCAACCGACGCGCTAGATGGAGAAAGCAAGCAGGAGCCAACCAGCTTATGGCATTCAACCACCTGATTCCAGGGGCATTTCCTCCTGCAGCTATGCCAGCTCTGCCAACCTACCAGTTATCAGAGACCTCTTACCAGCCCACTTCTATACCACAAGCTGTGTCTGATCCAAGCAACACAGTTCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCCGAGAGCAGTTCGGCCTATTGTCTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGAACCCAGCCATTGGCAATGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGCGTTCCACATCAGCCTCAGACGGATTATGCTTTATCTCCTTTAACTGGAGGCCTTGAGCCTTCCACAGCTGTATCAGCAAGTTGCAGCCAGAGACTGGAACATATGAAGAGCTTGGACAGTCTATCAACATCGCAGTCTTATTGCCCAACGTACAGCACCTCAGGCTACAGCATGGAGCCTGTCACAGGATACCAATACCCACAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATNAAGGAGTGGTCCTTCTTGTGCTATAACACTCAGAATGGATACACAT
  5   1   2      skin Tbd7      out                        XL060l20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 NACGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGGGTTCCTCATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTTGAGCCTCCCACAGCTGTATCAGCAAGTTGCAGCCAGAGACTGGAACATATGAAGAGCTTGGACAGTCTATCAACATCACAGTCTTATTGCCCACCAACGTACAGCACCTCAGGTTACAGCATGGAGCCTATGACAGGATACCAATACCCACAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAATGGTCCCTCTTGTGCTATAACACTCAGAATGGATACTCATCATTGTACGAGGGGCTCCAACTGAAAGACAGAAACACAGCAAACCTTTATCCGTTACTCATGGAGAGTGTGGAATTCTACCATGTTGATGGATGGTTAGAATCAGTCATGGACCTGGTGTTTTGGCTAATGACTACATGATTCCACATATGGCATTCCAAGGGCAGAAGCCACAAACTGTTTACAATGAACTAGAAGCCTAAATTAGACTTCAAAACTGCATTTGCCATGTCCCGACAACCAACGTCCTTTTTGGAGAATTATTTGACATTGCATCTTATTATAGAGTGCACAGTAAACACAACTATGTTTTATAGAGTGGATAAAGCGCTATATCTCTCGATATTTCACATAAGTTGATTACCCAGTGACTCAATAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)