Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6959175.5                       8 END     1          16       12                calcium/calmodulin-dependent protein kinase II, delta isoform 1 [Mus musculus]
     2   2.0    0Xl3.1-IMAGE:4970593.5                       5 END     1          16       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:4684011-IMAGp.5                 9 PI      77          1      341                calcium/calmodulin-dependent protein kinase II gamma M subunit [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:6959175.5                       8 PI      95        776      901                calcium/calmodulin-dependent protein kinase II, delta isoform 1 [Mus musculus]
     5   0.0    0Xl3.1-IMAGE:5542328.5                       8 PI      78          1      768                calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma [Xenopus tropicalis]
     6   0.0    0Xl3.1-IMAGE:6958312.5                       5 PI      78          2      346                Unknown (protein for MGC:122855) [Xenopus tropicalis]
     7   0.0    0Xl3.1-IMAGE:4755585-IMAGp.5                 3 PI      80        329      801                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012782147 Xl3.1-IMAGE:7020221.5 - 6 ESTs
                                                                       ...-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7020221.5                                                                                                                                                                                                                                                                                                      AAAGCTATCTGCTAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTGAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGACTTAGTTACAGGTGGAGAACTATTTGAAGATATAGTAGCAAGAGAGTACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGGGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTGGCAGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAACAGGCATGGTTTGGTTTTGCTGGCACTCCAGGTTATTTGTCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGACATGTGGGCATGTGGTGTCATTCTCTACATTCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAGCACAGGCTTTATCAGCAGATTAAGGCTGGTGCATATGATTTCCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAGATGCTCACAATCAATCCAGCCAAGCGTATCAATGCTACAGAAGCACTCAGACATCCTTGGATCTGTCAACGGTCTACTGTTGCCTCCATGATGCACAGACAGGAAACTGTGGATTGCTTGAAGAAATTCAATGCAAGAAGAAAGCTAAAGGGGGCAATATTAACTACCATGCTGGCTACCAGAAACTTCTCAGCGAAGAGTTTACTGAAGAAACCAGATGGAGTCAAGATCAACAACAAAGCCAACGTTATAACCAGCCCTAAAGATCCTACCCCGCCTCTGGAGCCCCAAACTACAGTAATCCACAATCCTGC
                                                  Xl3.1-CHK-1012701908                                                                                                                                                                                                                                                                                                            ATCTGCTAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTGAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGACTTAGTTACAGGTGGAGAACTATTTGAAGATATAGTAGCAAGAGAGTACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGGGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTGGCAGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAACAGGCATGGTTTGGTTTTGCTGGCACTCCAGGTTATTTGTCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGACATGTGGGCATGTGGTGTCATTCTCTACATTCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAGCACAGGCTTTATCAGCAGATTAAGGCTGGTGCATATGATTTCCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAGATGCTCACAATCAATCCAGCCAAGCGTATCAATGCTACAGAAGCACTCAGACATCCTTGGATCTGTCAACGGTCTACTGTTGCCTCCATGATGCACAGACAGGAAACTGTGGATTGCTTGAAGAAATTCAATGCAAGAAGAAAGCTAAAGGGGGCAATATTAACTACCATGCTGGCTACCAGAAACTTCTCAGCGAAGAGTTTACTGAAGAAACCAGATGGAGTCAAGATCAACAACAAAGCCAACGTTATAACCAGCCCTAAAGATCCTACCCCGCCTCTGGAGCCCCAAACTACAGTAATCCACAATCCTGCTGATGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                           2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2       add Neu7      out                        XL005o18.5p GGAGCTACTCTGCGCCCTGCTGCTGCTGCCACCACCACCTCAGGATCCCGGCGCCGCCGCTTCTCTTGTCTGTCGTTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGCAGAAAAGCAGCAGGAGGAGGAGGAGGCGGCATGGCTACAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTCGGAAAGGGAGCATTCTCGGTGGTAAGAAGATGTATGAAGATCACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTATCTGCTAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTGAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGACTTAGTTACAGGTGGAGAACTATTTGAAGATATAGTAGCAAGAGAGTACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACGTTAATGGCATAGTACACAGGGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCCGCAGTGAAACTTGCAGATTTTGGG
  5   1   2       bld Te2                             IMAGE:7393920.5p                                                                                                                                                                                                                                                                  GCACGGGGCCCCCGAGGTTCACAACCCGGTGGGCCCCGACTGCGCCAGTCCGACCCTGAAGGCAAAGCAAAATGCTTCTTTATTGCATTATAGAAAGCCACTGCTCCTGAGATTTCGACTCCATGACAGCATATCAGAGGAAGGATTCCATTATTTAGTCTTTGACTTAGTCACAGGTGGGGAACTATTTGAAGACATAGTAGCAAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGGGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTGGCAGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAACAGGCATGGTTTGGTTTTGCTGGCACTCCAGGTTATTTGTCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGACATGTGGGCATGTGGTGTCATTCTCTACATTCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAGCACAGGCTTTATCAGCAGATTAAGGCTGGTGCATATGATTTCCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAGATGCTCACAATCAATCCAGCCAAGCGTATCAATGCTACAGAAGCACTCAGACATCCTGGGATCTGTNCACGGTCTACTGTTGCCCTCATGATGCACAGACAGGAAACTG
  5   1   2       add Te2       out                   IMAGE:7390745.5p                                                                                                                                                                                                                                                                                            TAAACACCAAAAAGCTATCTGCTAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTGAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGACTTAGTTACAGGTGGAGAACTATTTGAAGATATAGTAGCAAGAGAGTACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACGTTAATGGCATAGTACACAGGGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCCGCAGTGAAACTTGCAGATTTTGGGTTAGCCATTGAAGTTCAAGGGGATCAGCAGGCATGGTTTGGTTTTGCTGGCACTCCAGGTTATTTGTCACCAGAAGTTTTACGGAAGGATCCCTATGGCAAGCCAGTGGATATGTGGGCATGTGGTGTCATCCTCTACATTCTTCTTGTTGGCTATCCACCTTTTTGGGATGAGGACCAGCACAGGCTTTATCAGCAGATTAAGGCTGGTGCATATGATTTCCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAAATGCTCACAATCAATCCAGCCAAGCGTATCACTGCTACAGAAGCACTCAGACATCCATGGATCTGTNCACGGTCTACTGTTGCCTCCATGATGCACAGACAGGAAACCGTGGATTGCCTGNAAGAGTTCATT
  5   1   2       bld Kid                             IMAGE:7010487.5p                                                                                                                                                                                                                                                                                                                                                                                                    ATATCAGAGGAAGGATTCCATTATTTAGTCTTTGACTTAGTCACAGGTGGGGAACTATTTGAAGACATAGTAGCAAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGGGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTGGCAGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAACAGGCATGGTTTGGTTTTGCTGGCACTCCAGGTTATTTGTCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGACATGTGGGCATGTGGTGTCATTCTCTACATTCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAGCACAGGCTTTATCAGCAGATTAAGGCTGGTGCATATGATTTCCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAGATGCTCACAATCAATCCAGCCAAGCGTATCAATGCTACAGAAGCACTCAGACATCCTTGGATCTGTCAACGGTCTACTGTTGCCTCCATGATGCACAGACAGGAAACTGTGGATTGCTTGAAGANATTCAATGGCAGAAGAAAGCTAAAGGGGGCAATATTAACTACCATGCTGGCTACCAGAAACTTCTCAGCGAAG
  5   1   2      seed Eye1                            IMAGE:7020221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTGGCAGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAACAGGCATGGTTTGGTTTTGCTGGCACTCCAGGTTATTTGTCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGACATGTGGGCATGTGGTGTCATTCTCTACATTCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAGCACAGGCTTTATCAGCAGATTAAGGCTGGTGCATATGATTTCCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAGATGCTCACAATCAATCCAGCCAAGCGTATCAATGCTACAGAAGCACTCAGACATCCTTGGATCTGTCAACGGTCTACTGTTGCCTCCATGATGCACAGACAGGAAACTGTGGATTGCTTGAAGAAATTCAATGCAAGAAGAAAGCTAAAGGGGGCAATATTAACTACCATGCTGGCTACCAGAAACTTCTCAGCGAAGAGTTTACTGAAGAAACCAGATGGAGTCAAGATCAACAACAAAGCCAACGTTATAACCAGCCCTAAAGATCCTACCCCGCCTCTGGAGCCCCAAACTACAGTAATCCACAATCCTGCTGATGGAAATAAGGAGTCAACAGAGAGCTCAAACACCACCATTGAAGATGAAGATGTAAAAGCCCGCAAACAAGAAATCATCAAAGTTACAGAGCAGCTTATTGAAGGCATAAATAATGGAGACTTTGAAGCCTATACAAAGAATTTGTGACCCAGGCCTTTACATCATTTGAAACAAGAAGCTCTGGGGAAATCT
  5   1   2       bld Eye1                            IMAGE:7019633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAAACTGGCAGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAACAGGCATGGTTTGGTTTTGCTGGCACTCCAGGTTATTTGTCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGACATGTGGGCATGTGGTGTCATTCTCTACATTCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAGCACAGGCTTTATCAGCAGATTAAGGCTGGTGCATATGATTTCCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAGATGCTCACAATCAATCCAGCCAAGCGTATCAATGCTACAGAAGCACTCAGACATCCTTGGATCTGTCAACGGTCTACTGTTGCCTCCATGATGCACAGACAGGAAACTGTGGATTGCTTGAAGAAATTCAATGCAAGAAGAAAGCTAAAGGGGGCAATATTAACTACCATGCTGGCTACCAGAAACTTCTCAGCGAAGAGTTTACTGAAGAAACCAGATGGAGTCAAGATCAACAACAAAGCCAACGTTATAACCAGCCCTAAAGATCCTACCCCGCCTCTGGAGCCCCAAACTACAGTAATCCACAATCCTGCTGATGGAAAATAAGGAGTCAACAGAGAGCTCAAACACCACCATTGAAGATGAAGATGTAAAAGCCCGCAAACCAGAAATCATCAAAGTTACAGAGCAACTTATTTGAAACCATAAATAATGGAGACTTTTAAGCCTATACAAAGAATTTGTGAACCAAGGCCCTACATCAATTGAAACCAGAAAGCTCTGGGGAAATCTAATTAAAAAGGAAGGGACCTTTCCATCCAATTTTATTTTTGAAAATGGCCCTATCCAAGAAGCAACAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)