Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:6938070.5                       5 END     2          25       40                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:6881144.3                       3 END     1          12       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6938070.5                       5 PI      92          1      161                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012782175 Xl3.1-IMAGE:6877359.3 - 8 ESTs
                                                                       ..-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6877359.3                                                                                                                                                                                                                                                                                                                                                                                     CATGATCACACATTTGGCTACAAATCTGGAAAACCTTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGCAACAAGACTGCTCCTCTTGTGAACTGTTCAGCTGAGAATGGAGAACTTGGCGATGTACAGTATTATCCAGGCAATGACACATATGGGACTATTGGTCTTCAGTACTTCCCATATTGTGGAAAGAAAATGCAGCCAAATTACACCAATCCTTTGGTAGCGGTGAAATTACTTAATCCGACACTGAACAAAGAACTGAGTGTAGTCTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACATGATCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAAATAAACCTCTTTCATCTAGTGCAAATTAAGCCATTGTAAGAACTACCTGGGATTCGCAATATCCTATGAAAAAACAAGCAGTGCTTCTGTCCTACTAACTTGAAGAAAACCATGGACCCATCATATCACATCATTTACCATGTTAATAGTCTCAGGAGGGGGCAACCAGTATATGAATTTACTTGCAAGCATATATATTATGATTTTGACATATGAATATCAGATCTCAAATACAAATAAAGGTAAAGTAATGTCATATTAAAATATATAAATAAATGCAATACTCCGGTTTTACGCTGCTTCTCCTGATGGGCTATTCTGTCATTCAAAAGTTCTAAACCAATGTACATTCTAAAAAGTTAAAAAGATTCAGTTGCAGGTCTTTGTATAGAAGTAGATTAAAAATGGCAACAGCATTTGACACAAGCCCACTTAAAATTAATAGTAACAAAGACAGGACAGAGAGAACAATGATATGTTGATATTTCATAAGTTTCTTTATGCATGAAAAGCTAATTAAAAAGTTCTCTCTTTTCATATTACCTTAAAAACTTTTTTATTATTAT
                                                  Xl3.1-CHK-1012698911                                                                                                                                                                                                                                                                                                                                                                                           CACACATTTGGCTACAAATCTGGAAAACCTTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGCAACAAGACTGCTCCTCTTGTGAACTGTTCAGCTGAGAATGGAGAACTTGGCGATGTACAGTATTATCCAGGCAATGACACATATGGGACTATTGGTCTTCAGTACTTCCCATATTGTGGAAAGAAAATGCAGCCAAATTACACCAATCCTTTGGTAGCGGTGAAATTACTTAATCCGACACTGAACAAAGAACTGAGTGTAGTCTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACATGATCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAAATAAACCTCTTTCATCTAGTGCAAATTAAGCCATTGTAAGAACTACCTGGGATTCGCAATATCCTATGAAAAAACAAGCAGTGCTTCTGTCCTACTAACTTGAAGAAAACCATGGACCCATCATATCACATCATTTACCATGTTAATAGTCTCAGGAGGGGGCAACCAGTATATGAATTTACTTGCAAGCATATATATTATGATTTTGACATATGAATATCAGATCTCAAATACAAATAAAGGTAAAGTAATGTCATATTAAAATATATAAATAAATGCAATACTCCGGTTTTACGCTGCTTCTCCTGATGGGCTATTCTGTCATTCAAAAGTTCTAAACCAATGTACATTCTAAAAAGTTAAAAAGATTCAGTTGCAGGTCTTTGTATAGAAGTAGATTAAAAATGGCAACAGCATTTGACACAAGCCCACTTAAAATTAATAGTAACAAAGACAGGACAGAGAGAACAATGATATGTTGATATTTCATAAGTTTCTTTATGCATGAAAAGCTAATTAAAAAGTTCTCTCTTTTCATATTACCTTAAAAAxxTTTTTATTATTATACTAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                          2     4     3     4     3     4     3     4     3     4     4     4     4     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     5     5     5     5     5     5     5     5     6     7     6     7     6     7     5     7     5     7     5     7     4     7     4     7     4     7     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     5     7     5     7     5     7     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4
  3   1   2       add Tad1      out                   IMAGE:6880068.3p TAATATTCGAGCCACAAGAGGGGTATCTAAACATGAAGAGCCCCGGAGCTCCCGTAAATTAGGTGAAGAGGAAGAAGCTATATTTGGAATCTTTGTTTTATCAGAACCGAGGGCATGACAAAACTTAAAAACAAATACCTTCCCCCAATTTTGATAACCCAAGCCCTTGTGGGGAATTTTACTTTGTCGGGTGTAACAAAACAAATTCCGGTTCCAGGGAAAAAAGGATGAAAACGCCAAAGCTGTTTTCAGGATCTGTTCCCAAGAAATTTTTCCATGTTGGCCCTTAAAAAAAGGGAGAATTAACAAAGTTCCTTGCCCAGTTTTACCCACAGGATATGGTTGGGAAAATTGGTTTGTGGGAACCATGATCACCACATTGGGCTATAAAATCTGGAACCACCATGTCTTTTTAATAAAAGATGAACCGAAATAATAAATTTTGTTCCAGGCAACAAGACCGTTCCACGTGTGAACTGTTCAGCTGAGAGTGGAGATCTTGGAGATGTACAGTATTATCCAGGCAATGACACTTTTGGGACAATTGGTTTTCAATTCTTCCCATACTGTGGAAAGAAAATGCAGCCAAATTACACCAATCCTTTGGTAGCGGTGAAATTACTTAATCAACCAGTGAACAAAGAACTGAGTGTAGTCTGTAAAGTTTCTGGACATGGCATCACTTCAGACAACCCACATGATCCCTATGAAGGAAAAGTATCGTTCAAACTTAAGATAGAAAATAAACCTGATTCATCTAGTGCACATTAAGCCATTGTAAGAACCAGGGATTCATCTTATTCTACAATAAAACAAGCAGTGCTTCTGTCCTTCTAACCCGAAGAAAACAATGGAACCATGTTTTCTCATCATTTACCATGTTAACAGTCTCAGAAAGGGAGCAACCAATATATGTATTTTTCACTTGCAAGCACTGATATATTATGATGTTGACATAGGAGTGTCAGATCTCTTTGGAAAAAACATCCCNCNCGTATAATTAATAATAATATCTTACGCATGGTGGNGGCGGGGTGGCG
  3   1   2      seed Tad1 5g3  out                   IMAGE:6877359.3p                                                                                                                                                                                                 CCCATTGTAAACCCGGTACGGGGGGATTTTTCTCCGGGGGTACAACAAATTCCGTTCAAGAAAAGGTTGAACGCAAATTGGTTTGGACCATACAAAGGATTTTTGGTGCTCATCAGGAATGAGAATAGGAAGTTCTGCCCATTTTATTAACAGATATGCTGGGAAATTGCTTTTGGGAACATGATTCACACATTTGGCTACAAATCGGGAAAACTTTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGCAACAAGACTGCTCTTTTTGTGAACTGTTCAGCTGAGAATGGAGAACTTGGCGATGTACAGTATTATCCAGGCAATGACACATATGGGACTATTGGTCTTCAGTACTTCCCATATTGTGGAAAGAAAATGCAGCCAAATTACACCAATCCTTTGGTAGCGGTGAAATTACTTAATCCGACACTGAACAAAGAACTGAGTGTAGTCTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACATGATCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAAATAAACCTCTTTCATCTAGTGCAAATTAAGCCATTGTAAGAACTACCTGGGATTCGCAATATCCTATGAAAAAACAAGCAGTGCTTCTGTCCTACTAACTTGAAGAAAACCATGGACCCATCATATCACATCATTTACCATGTTAATAGTCTCAGGAGGGGGCAACCAGTATATGAATTTACTTGCAAGCATATATATTATGATTTTGACATATGAATATCAGATCTCAAATACAAATAAAGGTAAAGTAATGTCATATTAAAATATATAAATAAATGCAATACTCCGGTATTTCGCC
  5   1   2       add Tad1                            IMAGE:6937446.5p                                                                                                                                                                                                                                                                                                GGCAAGAATCTCTTGTGCTCATCAGAATGAGAATACGAAGTCCTGCCAGTTTACTACAGATATGCTGGGAAATTGCTCTTGGGAACATGATCACACATTTGGCTACAAATCTGGAAAACCTTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGCAACAAGACTGCTCCTCTTGTGAACTGTTCAGCTGAGAATGGAGAACTTGGCGATGTACAGTATTATCCAGGCAATGACACATATGGGACTATTGGTCTTCAGTACTTCCCATATTGTGGAAAGAAAATGCAGCCAAATTACACCAATCCTTTGGTAGCGGTGAAATTACTTAATCCGACACTGAACAAAGAACTGAGTGTAGTCTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACATGATCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAAATAAACCCTCTTTCATCTAGTGCAAATTAAGCCATTGTTAAGAACTACCCTGGGAATTCGCAAATATCCTAATGaaaaaaaaCAAGGCAGGTGCCTTCTGGTTCCTACCTAACTTTTGAAGAAAAAACCCATGGGACCCCCTTCATTATTCACATTCAATTTTAACCAATGGTTAAATAAGGTTCTCCAGGGAAGGGGGGCCAAACCCAAGTTAT
  5   1   2       bld Tad1                            IMAGE:6938556.5p                                                                                                                                                                                                                                                                                                                                                                               GGGGAACATGATCACACATTTGGCTACAAATCTGGAAAACCTTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGCAACAAGACTGCTCCTCTTGTGAACTGTTCAGCTGAGAATGGAGAACTTGGCGATGTACAGTATTATCCAGGCAATGACACATATGGGACTATTGGTCTTCAGTACTTCCCATATTGTGGAAAGAAAATGCAGCCAAATTACACCAATCCTTTGGTAGCGGTGAAATTACTTAATCCGACACTGAACAAAGAACTGAGTGTAGTCTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACATGATCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAAATAAACCTCTTTCATCTAGTGCAAATTAAGCCATTGTAAGAACTACCTGGGATTCGCAATATCCTATGAAAAAACAAGCAGTGCTTCTGTCCTACTAACTTGAAGAAAACCATGGACCCATCATATCACATCATTTACCATGTTAATAGTCTCAGGAGGGGGCAACCAGTATATGAATTTACTTGCAAGCATATATATTATGATTTTGACATATGAATATCAGATCTCAAATACAAATAAAGGTAAAGTAATTGTCATATTAAAAATTTATAAATAAAATGCCAATACCTCCGGTTTTTTACGCCTGCCTTCTTCCTGGAAGGGGGCTAATTCCTGTTCATTTCCAAAAAGGTTCCCTAAAACCCAAATTGTAAACCATTCCA
  5   1   2       bld Tad1      out                   IMAGE:6877363.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTAGTCTGTAAAGTTTCTGGACATGGCATCACCTCGGACAACCCACATGATCCCTATGAAGGAAAAGTATCATTCAAACTTAAGATAGAAAATAAACCTCTTTCATCTAGTGCAAATTAAGCCATTGTAAGAACTACCTGGGATTCGCAATATCCTATGAAAAAACAAGCAGTGCTTCTGTCCTACTAACTTGAAGAAAACCATGGACCCATCATATCACATCATTTACCATGTTAATAGTCTCAGGAGGGGGCAACCAGTATATGAATTTACTTGCAAGCATATATATTATGATTTTGACATATGAATATCAGATCTCAAATACAAATAAAGGTAAAGTAATGTCATATTAAAATATATAAATAAATGCAATACTCCGGTTTTACGCTGCTTCTCCTGATGGGCTATTCTGTCATTCAAAAGTTCTAAACCAATGTACATTCTAAAAAGTTAAAAAGATTCAGTTGCAGGTCTTTGTATAGAAGTAGATTAAAAATGGCAACAGCATTTGACACAAGCCCACTTAAAATTAATAGTAACAAAGACAGGACAGAGAGAACAATGATATGTTGATATTTCATAAGTTTCTTTATGCATGAAAAGCTAATTAAAAAGTTCTCTCTTTTCATATTACCCTTAAAAACTTTTTATTATTATACTAATACTTCCCTTTAGGAATTTGATTTAATATATGCCCGAGGGGGTAAACTTCTCTAAACAAAGTGTAAAATGtttttttttCTGATAAACCCTAGGACAACCAGATTTTGTATTTCAATTTGCCCTTATATGCATTTTGAACCAATCCGAAAATAAATGCCTGAATTTCTAAATTATTGG
  5   1   2       bld Tad1                            IMAGE:6939546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGGAAAAGTATCATTCAAACTTAAGATAGAAAATAAACCTCTTTCATCTAGTGCAAATTAAGCCATTGTAAGAACTACCTGGGATTCGCAATATCCTATGAAAAAACAAGCAGTGCTTCTGTCCTACTAACTTGAAGAAAACCATGGACCCATCATATCACATCATTTACCATGTTAATAGTCTCAGGAGGGGGCAACCAGTATATGAATTTACTTGCAAGCATATATATTATGATTTTGACATATGAATATCAGATCtcaaatacaaataaaggtaaagtaatgtcatattaaaatatataaataaatgcaataCTCCGGTTTTACGCTGCTTCTCCTGATGGGCTATTCTGTCATTCAAAAGTTCTAAACCAATGTACATTCTAAAAAGTTAAAAAGATTCAGTTGCAGGTCTTTGTATAGAAGTAGATTAAAAATGGCAACAGCATTTGACACCAAGCCCACTTAAAATTAATAGCTACCAAGACAGGACCAAGAGAACAATGATATGTTTGATATTTCATAAGTTTCTTTATGCATGAAAAGCTAATTATAAAGTTCTCTCTTTTCATATTCCCTTAAAACTTTTTATTATTATACTAATACCTCCCTTTTAGGAAATTGATTTAATATATGCCCAAGGGGGTAACCTCTCTTAAACCAGTGGCTAAATGGTTTTTCTTTCCGGAAAACCCTAGGGAAAAACCAAAATTTGGTATTTTCCATTTTTGCCCCTAATAAGCCATTTTGGACCAATTCCCGAAAATTTATTGCCTGAATATTCTAAAAT
  5   1   2       bld Tad1                            IMAGE:6939015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGAAAAGTATCATTCAAACTTAAGATAGAAAATAAACCTCTTTCATCTAGTGCAAATTAAGCCATTGTAAGAACTACCTGGGATTCGCAATATCCTATGAAAAAAACAAGCAGTGCTTCTGTCCTACTAACTTGAAGAAAACCATGGACCCATCATATCACATCATTTACCATGTTAATAGTCTCAGGAGGGGGCAACCAGTATATGAATTTACTTGCAAGCATATATATTATGATTTTGACATATGAATATCAGATCtcaaatacaaataaaggtaaagtaatgtcatattaaaatatataaataaatgcaataCTCCGGTTTTACGCTGCTTCTCCTGATGGGCTATTCTGTCATTCAAAAGTTCTAAACCAATGTACATTCTAAAAAGTTAAAAAGATTCAGTTGCAGGTCTTTGTATAGAAGTAGATTAAAAATGGCAACAGCATTTGACACAAGCCCACTTAAAATTAATAGTAACAAAGACAGGACAGAGAGAACAATGATATGTTGATATTTCATAAGTTTCTTTATGCATGAAAAGCTAATTAAAAAGTTCTCTCTTTTCATATTACCTTAAAAAACTTTTATTATTATACTAATACTTCCTTTTAGGAATTGATTTAATATATGCCGAGGGGGTAAACTCTTCTAAACAAGTGTAAATGttttttttttCTGAAAACCTAAGAACAACCCAGATTTGGATTTCAAATTTGGCCTTATATGCATTTTGACCAATTCAGAAAAAAATTTGCCGGATTTCC
  5   1   2       bld Tad1                            IMAGE:6937384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGNGAAAAAACAAGCAGTGCTTCTGTCCTACTAACTTGAAGAAAACCATGGACCCATCATATCACATCATTTACCATGTTAATAGTCTCAGGAGGGGGCAACCAGTATATGAATTTACTTGCAAGCATATATATTATGATTTTGACATATGAATATCAGATCtcaaatacaaataaaggtaaagtaatgtcatattaaaatatataaataaatgcaataCTCCGGTTTTACGCTGCTTCTCCTGATGGGCTATTCTGTCATTCAAAAGTTCTAAACCAATGTACATTCTAAAAAGTTAAAAAGATTCAGTTGCAGGTCTTTGTATAGAAGTAGATTAAAAATGGCAACAGCATTTGACACAAGCCCACTTAAAATTAATAGTAACAAAGACAGGACAGAGAGAACAATGATATGTTGATATTTCATAAGTTTCTTTATGCATGAAAAGCTAATTAAAAAGTTCTCTCTTTTCATATTACCTTAAAAACTTTTATTATTATACTAATACTTCCTTTAGGAATTGATTTAATATATGCCGAGGGGTAAACTCTCTAAACAAGTGTAAATGttttttttCTGATAACCTAGGACAACCAGATTTGTATTTCAATTTTGCCTATATGCATTTGACCAATCAGAAATAATTGCTGATTTCTAATTATTGAATAGATTCCCTCCATAGTGAATTTTTTCCCTGTATTTTCACATTCATAAACCAAACACTTTTAAAATGTACAAGATGTTTTGGCGTTCATCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)