Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1  1.25    0Xl3.1-XL018j04.3                            8 END     4          50       50                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:3516876-IMAGp.5                 6 END     1          12       16                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012782516 Xl3.1-xlk57i20ex.5 - 8 ESTs
                                                                       ....-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk57i20ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGAGTTGGATCTGCTTCCAATCAGACTTACAACTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGTGGCGACAATAATATTTATCTTTATGGAGTGTTCGACGGGTATGAGGGCACCAGAGCCACCAACTTTGTGGGTCAGCGACTTGCAGCAGAACTCCTTCTGGGTCAGTTGCACCCTGATGTCACAGACGCAGAGGTCCGCAGAGTATTGCTACAGGCATTTGCTGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTGTTTAGCAGAAAAGACCAGCCTACTTTCCCAGCTTCCAGAGGGTGCTCTCCACCAAACACTTCCAAGCCAGTACCAAAAGATTGTAGACCGGCTTAACATACTCGAGAAGGAAATATATGGGGGAGCCATGGTCATTGTGGTGCTAATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAACCAGAGCACTTTTGTGTAAATCAACTGAAGACGGGCTCCAAGTAACTCAGCTCAATGCCGACCACACTACAGAAAACGAAGATGAGATATTCCGTCTGTCTCAGTTGGGGCTGGACACGACAAAGATTAACCAGGTGGA
                                                  Xl3.1-CHK-1012698455                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGAGTTGGATCTGCTTCCAATCAGACTTACAACTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGTGGCGACAATAATATTTATCTTTATGGAGTGTTCGACGGGTATGAGGGCACCAGAGCCACCAACTTTGTGGGTCAGCGACTTGCAGCAGAACTCCTTCTGGGTCAGTTGCACCCTGATGTCACAGACGCAGAGGTCCGCAGAGTATTGCTACAGGCATTTGCTGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTGTTTAGCAGAAAAGACCAGCCTACTTTCCCAGCTTCCAGAGGGTGCTCTCCACCAAACACTTCCAAGCCAGTACCAAAAGATTGTAGACCGGCTTAACATACTCGAGAAGGAAATATATGGGGGAGCCATGGTCATTGTGGTGCTAATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAACCAGAGCACTTTTGTGTAAATCAACTGAAGACGGGCTCCAAGTAACTCAGCTCAATGCCGACCACACTACAGAAAACGAAGATGAGATATTCCGTCTGTCTCAGTTGGGGCTGGACACGACAAAGATTAACCAGGTGGAGAGGGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                2     5     3     6     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     5     5     4     4     4     4     4     4     4     4     3     3     2     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 6e-009     NP_510428.1 TAK1 kinase/MOM-4 binding Protein TAP-1, TAB1-like protein (43.5 kD) (tap-1) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN --- At ---- 4e-009     NP_566554.1 protein phosphatase 2C-related / PP2C-related [Arabidopsis thaliana] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bt ---- 5e-017     NP_001095527.1 mitogen-activated protein kinase kinase kinase 7 interacting protein 1 [Bos taurus] --------------------------------------------------------------------------------================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Dr ---- 5e-021     XP_698383.3 PREDICTED: mitogen-activated protein kinase kinase kinase 7 interacting protein 1 [Danio rerio] ======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ag ---- 8e-037     XP_311946.4 AGAP002953-PA [Anopheles gambiae str. PEST] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 1e-050     XP_001189377.1 PREDICTED: similar to TAK1 binding protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Cf ---- 6e-087     XP_849785.1 PREDICTED: similar to Mitogen-activated protein kinase kinase kinase 7 interacting protein 1 (TAK1-binding protein 1) isoform 2 [Canis familiaris] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 1e-088     NP_705717.1 mitogen-activated protein kinase kinase kinase 7 interacting protein 1 isoformbeta; TAK1-binding protein 1; transforming growth factor beta-activatedkinase-binding protein 1 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 1e-089     NP_079885.2 mitogen-activated protein kinase kinase kinase 7 interacting protein 1;Tak1-binding protein 1; beta activated kinase-1 binding protein-1 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Gg ---- 4e-092     NP_001006240.1 similar to Mitogen-activated protein kinase kinase kinase 7 interacting protein 1 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 1e-111     NP_001081740.1 TAB1 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xt ==== 1e-118     AAI35830.1 Map3k7ip1 protein [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-xlk57i20ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2       bld Ooc3                   IMAGE:3473052-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATTCCCCGGGGAGGATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGAGTTGGATCTGCTTCCAATCAGACTTACAACTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGTGGCGACAATAATATTTATCTTTATGGAGTGTTCGACGGGTATGAGGGCACCAGAGCCACCAACTTTGTGGGTCAGCGACTTGCAGCAGAACTCCTTCTGGGTCAGTTGCACCCTGATGTCACAGACGCAGAGGTCCGCAGAGTATTGCTACAGGCATTTGCTGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTGTTTAGCAGAAAAGACCAGCCTACTTTCCCAGCTTCCAGAGGGTGCTCTCCACCAAACACTTCCAAGCCAGTACCAAAAGATTGTAGACCGGCTTAACATACTCGAGAAGGAA
  5   1   2       bld Ga18      out                      xlk57i20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCNCCGAGAAGGAATCTTCTGCATAGTGAGCAGCNGANNNACAGATGATCTCCCTCTCTGCAACCTTTCTGGAGTTGGATCTGCTTCCAATCAGACTTACAACTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGTGGCGACAATAATATTTATCTTTATGGAGTGTTCGACGGGTATGAGGGCACCAGAGCCACCAACTTTGTGGGTCAGCGACTTGCAGCAGAACTCCTTCTGGGTCAGTTGCACCCTGATGTCACAGACGCAGAGGTCCGCAGAGTATTGCTACAGGCATTTGCTGTTGTTGAAAGAAGNTTTCTGGATTCCATTGATGATTGTTTAGCAGAAAAGACCAGCCTACTTTCCCAGCTTCCAGAGGGTGCTCTCCACCAAACACTTCCAAGCCAGTACCAAAAGATTGTAGACCGGCTTAACATACTCGAGAAGGAAATATATGGGGGAGCCATGGTCATTGTGGTGCTAATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCAACTGAAGACGGGCTCCAAGTAACTCAGCTCAATGCCGACCACACTACAGAAAACGAAGATGAGATATTCCGTCTGTCTCAGTTGGGGCTGGACACGACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAANNACTCGCAGGATTGGA
  5   1   2       bld Ov1       out                   IMAGE:5047616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCGCCTAGAAGGAATCTTCTGCATAGTCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCCAATCAGACTTACAACTCAGAGGGCCTTGGGAAAGACGAGCACCCATATGAAGATAACTGGATAAAGTTCAGGGGCGACAATAATATTTATCTTTATGGAGTGTTTAACGGGTATGAGGGAACCAGAGCCACCAGCTTTGTGGGTCAGCGGCTTGCAGCAGAACTACTTCTGGGCCAGTTGGACCCTGATGTCACAGATGCAGAGGTCCACAAAGTATTGCTACAGGCATTTGATGTTGTTGAAAGAAGTTTTCTGGAGTCCATCGATGATTGCTTAGCAGAAAAGGCCAGCCTACTGTCCCAACTTCCAGAGGGTACTCTGCACCAAACACTTCCAAGCCAGTACCAAAAGATTGTGGACCGGGCTAACATACTTGAGAAGGAAATATATGGGGGAGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTCGGAACAACAGAGCACTTTTTGTGTAAT
  5   1   2       bld Ooc3      out                   IMAGE:3473052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGAGTTGGATCTGCTTCCAATCAGACTTACAACTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGTGGCGACAATAATATTTATCTTTATGGAGTG
  5   1   2       bld Neu7      out                        XL018j04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TNCTGCATAGTGAGCAGCAGNANCTGGTACAGNATGATCTCCCTCTCTGCAACCTTTCTGGAGTTGGATCTGCTTCCAATCAGACTTACAACTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGTGGCGACAATAATATTTATCTTTATGGAGTGTTCGACGGGTATGAGGGCACCAGAGCCACCAACTTTGTGGGTCAGCGACTTGCAGCAGAACTCCTTCTGGGTCAGTTGCACCCTGATGTCACAGATGCAGAGGTCCGCAGAGTATTGCTACAGGCATTTGCTGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTGTTTAGCAGAAAAGACCAGCCTACTTTCCCAGCTTCCAGAGGGTGCTCTCCACCAAACACTTCCAAGCCAATACCAAAAGATTGTAGACCGGCTTAACATACTCGAGAAGGAAATATATGGGGGAGCCATG
  5   1   2      seed Gas6      out                   IMAGE:3474618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGAGTTGGATCTGCTTCCAATCAGACTTACAACTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGTGGCGACAATAATATTTATCTTTATGGAGTGTTCGACGGGTATGAGGGCACCAGAGCCACCAACTTTGTGGGTCAGCGACTTGCAGCAGAACTCCTTCTGGGTCAGTTGCACCCTGATGTCACAGACGCAGAGGTCCGCAGAGTATTGCTACAGGCATTTGCTGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTGTTTAGCAGAAAAGACCAGCCTACTTTCCCAGCTTCCAGAGGGTGCTCTCCACCAAACACTTCCAAGCCAGTACCAAAAGATTGTAGACCGGCTTAACATACTCGAGAAGGAAATATATGGGGGAGCCATGGTCATTGTGGTGCTAATTGTGAACAGCAAACTTTATGTTGCAAATGTT
  5   1   2       bld Gas6                   IMAGE:3474618-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGAGCACCCATAGGGAAGATAACTCGGATAAAGTTCAGTGGCGACAATAATATTTATCTTTATGGAGTGTTCGACGGGTATGAGGGCACCAGAGCCACCAACTTTGTGGGTCAGCGACTTGCAGCAGAACTCCTTCTGGGTCAGTTGCACCCTGATGTCCCAGACGCAGAGGTCCGCAGAGTATTGCTACAGGCATTTGCTGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTGTTTAGCAGAAAAGACCAGCCTACTTTCCCAGCTTCCAGAGGGTGCTCTCCACCAAACACTTCCCAGCCAGTACCAAAAGATTGTAGACCGGCTTAACATACTCGAGAAGGAAATATATGGGGGAGCCATGGTCATTGTGGTGCTAATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAACCAGAGCACTTTTGTGTAAATCAACTGAAGACGGGCTCCAAGTAACTCAGCTCAATGCCGACCACACTACAGAAAACGAAGATGAGATATTCCGTCTGTCTCAGTTGGGGCTGGACACGACAAAGATTAACCAGGTGGAGAGAGTAAAACGGATTCATCATGATACTTTTGCAAGTGGTGCTGAACGTGCCAAGTTTTGCACTAAGCACGAAGACATGACTCTACTTGTGCGGAACCTGGGCTACCCACTAAGGACATCAGCCCACCCACCCCTTACG
  5   1   0       add Em10                            IMAGE:7980170.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGCACTCGCAGGATTGGAGACTACAAGGTCAAGTACAACTTCAATGACATTGAGCTGCTAAGCACAGCCAAGTCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGACGGTGTCACAGGATTTTTGGTTCTAATGTCTGAAGGACTTTACAAGGCTCTCGAGTCAGCCCATGGGCCTGGACAGGCCAACCAGGAAATAGCAGCCATGATTGCCACCGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTTTGGTGGAGAGGGTAAAACGGATTCACCATGATACGTTTGCAAGTGGTGGCGAACGGGCAAAATATTGCAGTAAGCACGAAGACATGACGCTACTTGTGCGGAACCTGGGCTACCCGCTTCAGGAGATCAGCCCCCCCACACTCACGCCCACTCAAGGTGGACGTTTATATCCAGTGTCTGTGCCATATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTCACACTGTCACTGGTGATGCCGTCACAGGGTCCAATGGTGAATGGAACAAACAGCAGCTCAACACTGGATGGAAACACGTCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACAACACTCACACTCAAAGCAGCATTCCAGTTCTGATGAAGCCTGTCCGATCTCGCCATTGCCTCTTTGCAGCAGATGAGATGGCCCGTGGACCCTACGTTACTCAAGATTTTTCCGCTTTGATGCAACAAATGATCAGGACTCGCTCCTGCATGAACAAATTATTCTAACTCCACTGTATGAAACTCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)