Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 30 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6324598.5.5                    29 PI      77        361      950                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:3436361-IMAGp.5                11 PI      77        397      673                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012782565 Xl3.1-IMAGE:4677875-IMAGp.5 - 6 ESTs
                                                                       ........-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4677875-IMAGp.5                                                                                                                       CTTCTTTGGAAAGATACTTAGACCAATGTGATGCTGAGGATGTCTTGGCTTCCTCACATATGTTCACCCCAATGACTCCATACGATGATCTAGCAATACAACCACTTCCAGGAACGTCCTATTCTTCTACACTTGAGCACTCCAAGGAACTGTCCACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAACCAAGAAAATGAGGATCAGCAAGAACAAACTCCATCACAATCACTGGAGCATGATAGTGGTATCTGTCTGGATGCCTCTAATTTGTCTCAGCCATTCACACCTTCTGAATGCAGAGATGCTACCCAAGATTCATCTAACCTATGTACCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACTCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAAAATATTGTGTCCACTGTGAATTTAGCCTGCAAACTAGACCTAAAAAAGATTGCACTTCATGCCAGAAATGCAGAATACAATCCGAAGAGATTTGCTGCAGTAATCATGCGGATCAGAGAACCTAGAACAACAGCACTCATATTCAGCTCTGGAAAAATGGTCTGCACTGGTGCAAAAAGCGAAGAACAGTCCAGACTGGCGGCTAGGAAATATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGGCTAGAAGGTTTGGTATTAACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCTGGGCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATCTTTGTCTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATATCCCATTCTAAAAGGTTTTAAGAAAACGACATAAGTCCCTCCATTAAGACAGATAAATTATTGTTTGT
                                                  Xl3.1-CHK-1012703114                                                                                                                             TGGAAAGATACTTAGACCAATGTGATGCTGAGGATGTCTTGGCTTCCTCACATATGTTCACCCCAATGACTCCATACGATGATCTAGCAATACAACCACTTCCAGGAACGTCCTATTCTTCTACACTTGAGCACTCCAAGGAACTGTCCACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAACCAAGAAAATGAGGATCAGCAAGAACAAACTCCATCACAATCACTGGAGCATGATAGTGGTATCTGTCTGGATGCCTCTAATTTGTCTCAGCCATTCACACCTTCTGAATGCAGAGATGCTACCCAAGATTCATCTAACCTATGTACCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACTCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAAAATATTGTGTCCACTGTGAATTTAGCCTGCAAACTAGACCTAAAAAAGATTGCACTTCATGCCAGAAATGCAGAATACAATCCGAAGAGATTTGCTGCAGTAATCATGCGGATCAGAGAACCTAGAACAACAGCACTCATATTCAGCTCTGGAAAAATGGTCTGCACTGGTGCAAAAAGCGAAGAACAGTCCAGACTGGCGGCTAGGAAATATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGGCTAGAAGGTTTGGTATTAACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCTGGGCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATCTTTGTCTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATATCCCATTCTAAAAGGTTTTAAGAAAACGACATAAGTCCCTCCATTAAGACAGATAAATTATT
                                                      consensus depths                                                                                                                            2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3
                                                                                                           PROTEIN --- Ce ---- 2e-085     NP_498635.1 TATA-Binding Protein (36.6 kD) (tbp-1) [Caenorhabditis elegans] ----------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Ag ---- 1e-094     XP_309748.2 AGAP010958-PA [Anopheles gambiae str. PEST] ---------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Dm ---- 9e-095     NP_523805.1 TATA binding protein CG9874-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 2e-096     XP_795391.2 PREDICTED: similar to TATA binding protein, partial [Strongylocentrotus purpuratus] -----------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Mm ---- 3e-105     NP_038712.3 TATA box binding protein [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Bt ---- 2e-106     NP_001069210.1 TATA box binding protein [Bos taurus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Dr ---- 2e-113     NP_999961.1 TATA box binding protein like 2 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PREDICTED - Cf ---- 2e-117     XP_853710.1 PREDICTED: similar to TATA box binding protein like 2 [Canis familiaris] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 2e-119     XP_871896.3 PREDICTED: similar to TATA box binding protein like 2 [Bos taurus] -------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                             PROTEIN --- Hs ---- 7e-122     NP_950248.1 TATA box binding protein like 2; TBP-related factor 3 [Homo sapiens] -----========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN --- Gg ---= 9e-124     NP_001092323.1 TATA box binding protein like 2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN --- Xt ==== 7e-172     CAJ81377.1 Novel protein similar to TBP [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN --- Xl ==== 7e-180     NP_001080921.1 TBP-related factor 3 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4677875-IMAGp.5                                                                                                                                                                                  ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld Egg1                               PBX0065A07.5p                                                                                         ACGAGGAGACCCTCAAAATGGATGGAGAGTCTTCTTTGGAAAGATACTTAGACCAATGTGATGCTGAGGATGTCTTGGCTTCCTCACATATGTTCACCCCAATGACTCCATACGATGATCTAGCAATACAACCACTTCCAGGAACGTCCTATTCTTCTACACTTGAGCACTCCAAGGAACTGTCCACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAACCAAGAAAATGAGGATCAGCAAGAACAAACTCCATCACAATCACTGGAGCATGATAGTGGTATCTGTCTGGATGCCTCTAATTTGTCTCAGCCATTCACACCTTCTGAATGCAGAGATGCTACCCAAGATTCATCTAACCTATGTACCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACTCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAAAATATTGTGTCCACTGTGAATTTAGCCTGCAAACTAGACCTAAAAAAGATTGCACTTCATGCCAGAAATGCAGAATACAATCCGAAGAGATTTGCTGCAGTAATCATGCGGATCAGAGAACCTAGAACAACAGCACTCATATTCAGCTCTGGAAAAATGGTCTGCACTGGTGCAAAAAGCGAAGAACA
  5   1   2       bld Egg1                               PBX0005C09.5p                                                                                                                       CTTCTTTGGAAAGATACTTAGACCAATGTGATGCTGAGGATGTCTTGGCTTCCTCACATATGTTCACCCCAATGACTCCATACGATGATCTAGCAATACAACCACTTCCAGGAACGTCCTATTCTTCTACACTTGAGCACTCCAAGGAACTGTCCACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAACCAAGAAAATGAGGATCAGCAAGAACAAACTCCATCACAATCACTGGAGCATGATAGTGGTATCTGTCTGGATGCCTCTAATTTGTCTCAGCCATTCACACCTTCTGAATGCAGAGATGCTACCCAAGATTCATCTAACCTATGTACCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACTCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAAAATATTGTGTCCACTGTGAATTTAGCCTGCAAACTAGACCTAAAAAAGATTGCACTTCATGCCAGAAATGCAGAATACAATCCGAAGAGATTTGCTGCAGTAATCATGCGGATCAGAGAACCTAGAACAACAGCACTCATATTCAGCTCTGGAAAAATGGTCTGCACTGGTGCAAAAAGCGAAGAACAGTCCAGACTGGCGGCTAGGAAATATGCACGAGTGGTACAG
  5  -1   2       bld Bla2                            IMAGE:7298126.5p                                                                                                                                                                                                                                                                                                                                                             GGACAACTCCATCACAACACTGAGCATGATAGTGTATCTGCTGGATGCTCTAATTTGTCTCAGCCATTCACACCTTCTGAATGCAGAGATGCTACCCACGATTCATCTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACTCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAAAATATTGTGTCCACTGTGAATTTAGCCTGCAAACTAGACCTAAAAAAGATTGCACTTCATGCCAGAAATGCAGAATACAACCCGAAGAGATTTGCTGCAGTAATCATGCGGATCAGAGAACCTAGAACAACAGCACTCATATTCAGCTCTGGAAAAATGGTCTGCACTGGTGCAAAAAGCGAAGAACAGTCCAGACTGGCGGCTAGGAAATATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGGCTAGAAGGTTTGGTATTAACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCTGGGCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATCTTTGTCTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATATCCCATTCTAAAAGGTTTTAAGAAAACGACATAAGTCCCTCCATTAAGACAGATAAATTATTGTTTGTNAAAAGAAAGGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATCGCCTATGACGG
  5   1   2      seed Egg2                   IMAGE:4677875-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                         TGCCTCTAATTTGTCTCAGCCATTCACACCTTCTGAATGCAGAGATGCTACCCAAGATTCATCTAACCTATGTACCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACTCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAAAATATTGTGTCCACTGTGAATTTAGCCTGCAAACTAGACCTAAAAAAGATTGCACTTCATGCCAGAAATGCAGAATACAATCCGAAGAGATTTGCTGCAGTAATCATGCGGATCAGAGAACCTAGAACAACAGCACTCATATTCAGCTCTGGAAAAATGGTCTGCACTGGTGCAAAAAGCGAAGAACAGTCCAGACTGGCGGCTAGGAAATATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGGCTAGAAGGTTTGGTATTAACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCTGGGCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATCTTTGTCTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATATCCCATTCTAAAAGGTTTTAAGAAAACGACATAAGTCCCTCCATTAAAGACAGATAAAATTATTGTTTgtataatatatgtaaataaaaattaatagtttttgaaaaaaaataaaggctttatttaacacactataacaaaaaaaaaaacaaaaaaaGATTCGCG
  5   1   2       bld Egg1                            IMAGE:4678623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCATTTGCAAAATATTGTGTCCACTGTGAATTTAGCCTGCAAACTAGACCTAAAAAAGAATGCACTTCATGCCAGAAATGCAGAATACAATCCGAAGAGAATNGCTGCAGTAATCATGCGGAACAGAGAACCCAGAACAACAGCACTCATATTC
  3   1   2       bld Egg1                            IMAGE:4677875.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCACTGTGAATTTAGCCTGCAAACTAGACCTAAAAAAGATTGCACTTCATGCCAGAAATGCAGAATACAATCCGAAGAGATTTGCTGCAGTAATCATGCGGATCAGAGAACCTAGAACAACAGCACTCATATTCAGCTCTGGAAAAATGGTCTGCACTGGTGCAAAAAGCGAAGAACAGTCCAGACTGGCGGCTAGGAAATATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGGCTAGAAGGTTTGGTATTAACTCATCAGCAGTTTAACAGCTATGAACCTGAATTGTTTCCTGGGCTCATCTATAGAATGGTGAAGCCAAGAATTGTTCTGCTTATCTTTGTCTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATATCCCATTCTAAAAGGTTTTAAGAAAACGACATAAGTCCCTCCATTAAGACAGATAAATTATTGTTTGTATAATATATGTAAATAAAAATTAATAGTGGGAAAAAAAATAAAGGCTTTATTTAACACACTATAACAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)