Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7764618.3.5                    84 END     1          16        1                (no blast hit)
     2   2.0    0Xl3.1-XL472k09ex.5                         28 END     1          16        3                Novel protein containing short chain dehydrogenase domain [Xenopus tropicalis]
     3   1.0    0Xl3.1-IMAGE:8529836.5                       4 END     1          16       25                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012782567 Xl3.1-IMAGE:8823928.3 - 6 ESTs
                                                                       .-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8823928.3                                                                                                                                                                                                          GGTTGGGAGATTGCAGGGAGATTGCAACTCGCGATCGTTTGTCAGACATGGGATAGAATCTTTCTATTGCCAGCTTTACTGAAGTACGTGACCTCATTATAGCCAGTAACTAGTTTATATTTAGAAAAATGCATTTGTTTGCATTAGACTTAATGCAAGTTTTGTTGTTCCCGAACTGTTGGATTTATACTTATCCTTTTTTTTCTCATGCAAAACACATTCACTCCATGTTTAAAATTGTTTAGCATAAAATGAGCTTTGCAACATTACATGCCTAACCTAATATTTTTTCTAACGGCTTTACTAGAACAGTGCAAGTTTATAGTTTACAGTAGCTGTTACTGTTGTTTTGTATGGTTGGGAAGAGAGCCTCAGCCAAGGCAAACAATATAGCATAGTTTCCACTATTGCTATAATTTATAAACACAAATATACTCTGGACAAATGCTCTTTGCACACAAATTATGCCTTTATTATACTTGTATTAATTCCGCCATGATGTTGGGACTGGATTGGGATATCACTTGAAAATTGTGCATCTTTCTTTGCAAACTTTTCTGCCTTTGATTCCTAATAACTTCATAATGTAAGCATATTTTTTAAATATGCTGCCCACTTCTGTTCTCCTATACACAAATGTTGAGGTGCAAGGTAATAGTGGAAATATATAGAGAATAAGTTCGGCAACACCTTTAATACATGTGTAAAGAGAAGTCCTGGTTTTGCTGGTCTTTTACATATATACACACAGCCCATTCTGATATTGAGAAACTATTTGGTTGACTGGATAGTCTATCAAATACT
                                                  Xl3.1-CHK-1012701064                                                                                                                                                                                                                GAGATTGCAGGGAGATTGCAACTCGCGATCGTTTGTCAGACATGGGATAGAATCTTTCTATTGCCAGCTTTACTGAAGTACGTGACCTCATTATAGCCAGTAACTAGTTTATATTTAGAAAAATGCATTTGTTTGCATTAGACTTAATGCAAGTTTTGTTGTTCCCGAACTGTTGGATTTATACTTATCCTTTTTTTTCTCATGCAAAACACATTCACTCCATGTTTAAAATTGTTTAGCATAAAATGAGCTTTGCAACATTACATGCCTAACCTAATATTTTTTCTAACGGCTTTACTAGAACAGTGCAAGTTTATAGTTTACAGTAGCTGTTACTGTTGTTTTGTATGGTTGGGAAGAGAGCCTCAGCCAAGGCAAACAATATAGCATAGTTTCCACTATTGCTATAATTTATAAACACAAATATACTCTGGACAAATGCTCTTTGCACACAAATTATGCCTTTATTATACTTGTATTAATTCCGCCATGATGTTGGGACTGGATTGGGATATCACTTGAAAATTGTGCATCTTTCTTTGCAAACTTTTCTGCCTTTGATTCCTAATAACTTCATAATGTAAGCATATTTTTTAAATATGCTGCCCACTTCTGTTCTCCTATACACAAATGTTGAGGTGCAAGGTAATAGTGGAAATATATAGAGAATAAGTTCGGCAACACCTTTAATACATGTGTAAAGAGAAGTCCTGGTTTTGCTGGTCTTTTACATATATACACACAGCCCATTCTGATATTGAGAAACTATTTGGTTGACTGGATAGTCTATCAAATACTTCCAAG
                                                      consensus depths                                                                                                                                                                                                               2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     3     3     3     3     2     3
                                                 Xl3.1-IMAGE:8823928.3                                                                                                                                                                                                                                                                                                             TAG------------------------------------------TAG---TAA------------------------------------------------------ATG------------------------------------------TGA---------------ATG---------------------------------------------------------------------------------------------------------------------TAG---------------------------TAA---------------------ATG------------------------------------------------ATGATG------------------------TGA------------------------------------TGA---------------TAA---------------TAA---------------------------------ATG------------------------------------TAA---------------TAA---ATG------------------------------------------------------------------------------TGA
  5   1   2       bld Ga12                                 XL220h21.5p GCACGAGGCTGGCTATACACACAAAGATTAAGTTGTACGAAACAAAGCTTTGTATGATTTTCAGGTTAGAAGATGTCTGACAGTTAATGATAATATCCCTGCATGTATAACATAACTTTTGTACAATTGCCGTCATCGGCAGAACGTAGTCTGATTTGTTCTTTTACTACTTTATCTATTTAATCTGAATGGTAAGTGGCAGGTTGGGAGATTGCAGGGAGATTGCAACTCGCGATCGTTTGTCAGACATGGGATAGAATCTTTCTATTGCCAGCTTTACTGAAGTACGTGACCTCATTATAGCCAGTAACTAGTTTATATTTAGAAAAATGCATTTGTTTGCATTAGACTTAATGCAAGTTTTGTTGTTCCCGAACTGTTGGATTTATACTTATCCttttttttCTCATGCAAAACACATTCACTCCATGTTTAAAATTGTTTAGCATAAAATGAGCTTTGCAACATTACATGCCTAACCTAATATTTTTTCTAACGGCTTTACTAGAACAGTGCAAGTTTATAGTTTACAGTAGCTGTTACTGTTGTTTTGTATGGTTGGGAAGAGAGCCTCAGCCAAGGCAAACAATATAGCATAGTTTCCACTATTGCTATAATTTATAAACACAAATATACTCTGGACAAATGCTCTTTGCACACA
  3   1   2       bld Int2      out                   IMAGE:8823928.3p                                              CTATATAGGTGGCTAACCCAACGTAGGTACGATCAGCTGTAGTTTCAGGTAGAGAGTCGACAGTATGATATATGCTGCAATGATAACATACTTTGTACCATGCGTCATCGCAGACGTAGTCTGATTTGTCCTTACTACTTATCTATTATCTGATGTAGTGCAGTGGGAGATGCAGGGAGATGCAACTCGCGATCGTTTGTCAGACATGGGATAGAATCTTCTATTGCCAGCTTACTGAAGTACGTGACCTCATTATAGCCAGTAACTAGTTTATATTTAGAAAAATGCATTTGTTTGCATTAGACTTAATGCAAGTTTTGTTGTTCCCGAACTGTTGGATTTATACTTATCCTTTTTTTTCTCATGCAAAACACATTCACTCCATGTTTAAAATTGTTTAGCATAAAATGAGCTTTGCAACATTACATGCCTAACCTAATATTTTTTCTAACGGCTTTACTAGAACAGTGCAAGTTTATAGTTTACAGTAGCTGTTACTGTTGTTTTGTATGGTTGGGAAGAGAGCCTCAGCCAAGGCAAACAATATAGCATAGTTTCCACTATTGCTATAATTTATAAACACAAATATACTCTGGACAAATGCTCTTTGCACACAAATTATGCCTTTATTATACTTGTATTAATTCCGCCATGATGTTGGGACTGGATTGGGATATCACTTGAAAATTGTGCATCTTTCTTTGCAAACTTTTCTGCCTTTGATTCCTAATAACTTCATAATGTAAGCATATTTTTTAAATATGCTGCCCACTTCTGTTCTCCTATACACAAATGTTGAGGTGCAAGGTAATAGTGGAAATATATAGAGAATAAGTTCGGCAACACCTTTAATACATGTGTAAAGAGAAGTCCTGGTTTTGCTGGTCTTTTACATATATACACACAGCCCATTCTGATATCGAGAAACTATTTGGGTGACTGGATGGACAGCCAACATAAA
  5   1   2       bld Tad1                            IMAGE:6937928.5p                                                                                                                                                                                                  GGGTGGCAGGTTGGGAGATTGCAGGGAGATTGCAACTCGCGATCGTTTGTCAGACATGGGATAGAATCTTTCTATTGCCAGCTTTACTGAAGTACGTGACCTCATTATAGCCAGTAACTAGTTTATATTTAGAAAAATGCATTTGTTTGCATTAGACTTAATGCAAGTTTTGTTGTTCCCGAACTGTTGGATTTATACTTATCCttttttttCTCATGCAAAACACATTCACTCCATGTTTAAAATTGTTTAGCATAAAATGAGCTTTGCAACATTACATGCCTAACCTAATATTTTTTCTAACGGCTTTACTAGAACAGTGCAAGTTTATAGTTTACAGTAGCTGTTACTGTTGTTTTGTATGGTTGGGAAGAGAGCCTCAGCCAAGGCAAACAATATAGCATAGTTTCCACTATTGCTATAATTTATAAACACAAATATACTCTGGACAAATGCTCTTTGCACACAAATTATGCCTTTATTATACTTGTATTAATTCCCGCCATGATGTTGGGGACTGGGATTGGGGATATTCCCTGGAAAATTGTGGCATCTTTTCTTTTGCAAAACTTTTCTGCCCTTTTGAATCCCTAAATAACCTCCATAAATGTAAAGCATTAttttttttAAAATATGGCTGCCCCAACTTCCGGTTTCTCCCTATTACCACCAATGGTTTGAAGGGTGCCAAGGGTAATTAGGGGGGAAAATTTTTTTGGGAGGAATTAGGTTTCCGGCCAAACACCCTTTT
  3   1   2      seed Ov1  5x3  out                   IMAGE:5073222.3p                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCATGTTTAAAATTGTTTAGCATAAAATGAGCTTTGCAACATTACATGCCTAACCTAATATTTTTTCTAACGGCTTTACTAGAACAGTGCAAGTTTATAGTTTACAGTAGCTGTTACTGTTGTTTTGTATGGTTGGGAAGAGAGCCTCAGCCAAGGCAAACAATATAGCATAGTTTCCACTATTGCTATAATTTATAAACACAAATATACTCTGGACAAATGCTCTTTGCACACAAATTATGCCTTTATTATACTTGTATTAATTCCGCCATGATGTTGGGACTGGATTGGGATATCACTTGAAAATTGTGCATCTTTCTTTGCAAACTTTTCTGCCTTTGATTCCTAATAACTTCATAATGTAAGCATATTTTTTAAATATGCTGCCCACTTCTGTTCTCCTATACACAAATGTTGAGGTGCAAGGTAATAGTGGAAATATATAGAGAATAAGTTCGGCAACACCTTTAATACATGTGTAAAGAGAAGTCCTGGTTTTGCTGGTCTTTTACATATATACACACAGCCCATTCTGATATTGAGAAACTATTTGGTTGACTGGATAGTCTATCAAATACTTCCAAGCCAAGGAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Egg6                            IMAGE:4435448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAACGGCTTTACTAGAACAGTGCAAGTTTATAGTTTACAGTAGCTGTTACTGTTGTTTTGTATGGTTGGGAAGAGAGCCTCAGCCAAGGCAAACAATATAGCATAGTTTCCACTATTGCTATAATTTATAAACACAAATATACTCTGGACAAATGCTCTTTGCACACAAATTATGCCTTTATTATACTTGTATTAATTCCGCCATGATGTTGGGACTGGATTGGGATATCACTTGAAAATTGTGCATCTTTCTTTGCAAACTTTTCTGCCTTTGATTCCTAATAACTTCATAATGTAAGCATATTTTTTAAATATGCTGCCCACTTCTGTTCTCCTATACACAAATGTTGAGGTGCAAGGTAATAGTGGAAATATATAGAGAATAAGTTCGGCAACACCTTTAATACATGTGTAAAGAGAAGTCCTGGTTTTGCTGGTCTTTTACATATATACACACAGCCCATTCTGATATTGAGAAACTATTTGG
  3   1   2       bld Oo1       out                   IMAGE:3405426.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGAGCCTCAGCCAAGGCAAACAATATAGCATAGTTTCCACTATTGCTATAATTTATAAACACAAATAATACTCTGGACAAATGCTCTTTGCACACAAATTAATGCCTTTATTATACTTGTATTAATTCCGCCATGATGTTGGGACTGGATTGGGATATCACTTGAAAATTGTGCATCTTTCTTTGCAAACTTTTCTGCCTTTGATTCCTAATAACTTCATAATGTAAGCATATTTTTTAAATATGCTGCCCACTTCTGTTCTCCTATACACAAATGTTGAGGTGCAAGGTAATAGTGGAAATATATAGAGAATAAGTTCGGCAACACCTTTAATACATGTGTAAAGAGAAGTCCTGGTTTTGCTGGTCTTTTACATATATACACACAGCCCATTCTGATATTGAGAAACTATTTGGTTGACTGGATAGTCTATCAAATACTTCCAAGCCAAGGAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)