Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xl319h16.3                           14 PI      91         83      719                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012782703 Xl3.1-IMAGE:8077705.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8077705.5 GTTCTGGGTACACTGGCTATAACTTTACACGAAGGAAACATACGGCTGATATGTCTGATAAGCTCAGATGCTGATTGAACTGAACTGAAGTGTTAAAATAAGATCATCACTTTAAAGGAAGATCATGTCTACCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATCGATACGTCACTAATAAGTTTGATACACAATTATTCCACACGATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGACGGTCATCTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCTTTTTACAGGGGATCCGATTGCTGTTTACTTACATTCAGCGTTGATGATTCCCAGAGTTTTCAAAACCTGAACAATTGGAAAAAGGAGTTTATCTACTATGCAGATGTCAAAGACCCAGACAGCTTTCCCTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAATGTTGCTGCAGCATTTGAAGAAGCTGTTCGGAGGGGTTTTAGCCATAGAAGGATAGATCCGATCACCTGAATACACACCAGATAACCGTTTACCCTGCATAAGAAAAACAAAAGCCCAACTACCTTCCCGTTGCATGTGAACTGGTTGGCATTGTGGAAAAGGGCAATTAAACCCCCTTTAAACCCCCC
                                                  Xl3.1-CHK-1012710432       GGTACACTGGCTATAACTTTACACGAAGGAAACATACGGCTGATATGTCTGATAAGCTCAGATGCTGATTGAACTGAACTGAAGTGTTAAAATAAGATCATCACTTTAAAGGAAGATCATGTCTACCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATCGATACGTCACTAATAAGTTTGATACACAATTATTCCACACGATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGACGGTCATCTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCTTTTTACAGGGGATCCGATTGCTGTTTACTTACATTCAGCGTTGATGATTCCCAGAGTTTTCAAAACCTGAACAATTGGAAAAAGGAGTTTATCTACTATGCAGATGTCAAAGACCCAGACAGCTTTCCCTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAATGTTGCTGCAGCATTTGAAGAAGCTGTTCGGAGGGTTTTTAGCCATAGAAGGATAGATCCGATCACCTGAATACACACCAGATAACCGTTTACCCTGCATAAGAAAAACAAAAGCCCAACTACCTTCCCxxxxxxTGTGAAxxGxxxGGCATTGTGGAAAAGGGCAATTAAACCCCCTTTAAACCCCCCTTTAAT
                                                      consensus depths      1     1     1     1     1     1     1     3     1     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1
                                               BLH ATG     124     819 
                                               BLH MIN     124     118 
                                               BLH MPR     118     118 
                                               BLH OVR     124    1120 
                                               CDS MIN     124     118 
                                               ORF LNG     124      23 
                                                                                                                                                                                                      PROTEIN --- Ci ==== 1e-025     NP_001027632.1 GTP-binding protein rab-2 homologue [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                PROTEIN --- Dm ==== 9e-052     NP_524472.1 Rab-protein 7 CG5915-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                             PROTEIN --- Ce ==== 8e-052     NP_496549.1 RAB family RAB-7 (23.4 kD) (rab-7) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                PREDICTED = At ==== 2e-053     NP_188512.1 Ras-related GTP-binding protein, putative [Arabidopsis thaliana] =========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PROTEIN === ?? ==== 6e-054     XP_645911.1 Rab GTPase [Dictyostelium discoideum AX4] =========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                PROTEIN === Os ==== 1e-054     NP_001056046.1 Os05g0516600 [Oryza sativa (japonica cultivar-group)] ============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                PREDICTED = Sp ==== 7e-068     XP_001203327.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PREDICTED = Dr ==== 2e-085     NP_001038931.1 hypothetical protein LOC751756 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PROTEIN === Mm ==== 1e-088     NP_062747.1 RAB9, member RAS oncogene family; Sid6061p; SID 99 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PROTEIN === Gg ==== 3e-090     NP_001008678.1 similar to Ras-related protein Rab-9A (Rab-9) [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PREDICTED = Cf ==== 2e-090     XP_537956.1 PREDICTED: similar to GTP-binding protein rab9 - dog [Canis familiaris] ==============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PROTEIN === Hs ==== 2e-090     NP_004242.1 RAB9A, member RAS oncogene family; RAB9, member RAS oncogene family [Homosapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PROTEIN === Bt ==== 1e-090     NP_001069006.1 RAB9A, member RAS oncogene family [Bos taurus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PROTEIN === Xt ==== 2e-095     AAI58965.1 Rab9a protein [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   PROTEIN === Xl ==== 2e-098     NP_001084671.1 RAB9A, member RAS oncogene family [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:8077705.5                    TAA------------------------TGA------TGATAA------ATG---------------TGA------------------------TAA---------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------TAA
                                                                   ORF                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  5   1   2       bld Emb1 5g                         IMAGE:6632747.5p GTTCTGGGTACACTGGCTATAACTTTACACGAAGGAAACATACGGCTGATATGTCTGATAAGCTCAGATGCTGATTGAACTGAACTGAAGTGTTAAAATAAGATCATCACTTTAAAGGAAGATCATGTCTACCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATCGATACGTCACTAATAAGTTTGATACACAATTATTCCACACGATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGACGGTCATCTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCTTTTTACAGGGGATCCGATTGCTGTTTACTTACATTCAGCGTTGATGATTCCCAGAGTTTTCAAAACCTGAACAATTGGAAAAAGGAGTTTATCTACTATGCAGATGTCAAAGACCCAGACAGCTTTCCCTTTGTTATCTTGNGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAATGTTGCTGCAGCATTTGAAGAAGCTGNNTCGGAGGGTTTTAGCCATAGAAGGATAGATCCGATCACCTGAATACACACCAGATAACCGTTTACCCTGCATAAGAAAAACAAAAGCCCAACTACCTTCCCTGCCTGNTTGAACTGGTTGGCATTGTGGAAAAGGGCAATTAAACCCCCTTTAAACCCCCCTTTAAT
  5   1   2       bld FaBN 5g                         IMAGE:8077705.5p                            CGCCTCTAGGAACTAGCCGAAAACAGGAGAGGACTCGCAGATGCTGATTGAACTGAACTGAAGTGTTAAAATAAGATCATCACTTTAAAGGAAGATCATGTCTACCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATCGATACGTCACTAATAAGTTTGATACACAATTATTCCACACGATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGACGGTCATCTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCTTTTTACAGGGGATCCGATTGCTGTTTACTTACATTCAGCGTTGATGATTCCCAGAGTTTTCAAAACCTGAACAATTGGAAAAAGGAGTTTATCTACTATGCAGATGTCAAAGACCCAGACAGCTTTCCCTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAATGTTGCTGCAGCATTTGAAGAAGCTGTTCGGAGGGTTTTAGCCATAGAGGATAGATCAGATNCACTGATACACACAGATACAGTTAACCTGCATAGAAAACAAAAGCCAACTACTTCCTGCTGTTGACTGTTGCATGTGAAAGGCAATAACCCT
  5   1   2      seed Egg1 5g                            PBX0145G03.5p                                GGCACGAGGGCGGGGGATGAACTGACAGCGTTCTGGATGCTGATTGAACTGAACTGAAGTGTTAAAATAAGATCATCACTTTAAAGGAAGATCATGTCTACCAAATCCTCACTGCTGAAAATAATTCTTCTGGGAGATGGAGGAGTGGGAAAAAGTTCTCTCATGAATCGATACGTCACTAATAAGTTTGATACACAATTATTCCACACGATAGGTGTTGAGTTCCTCAATAAAGAGCTGGAAGTGGACGGTCATCTGGTTACAATGCAGATCTGGGACACTGCAGGCCAGGAGCGCTTTAGGAGCCTGAGAACCCCTTTTTACAGGGGATCCGATTGCTGTTTACTTACATTCAGCGTTGATGATTCCCAGAGTTTTCAAAACCTGAACAATTGGAAAAAGGAGTTTATCTACTATGCAGATGTCAAAGACCCAGACAGCTTTCCCTTTGTTATCTTGGGAAACAAAATAGACATCACAGACCGCCAGGTGTCCGTTGAAGAGGCCCAGGCCTGGTGTAGAGACAATGGAAATCATCCCTATTTTGAAACTAGCGCTAAAGATGCCACAAATGTTGCTGCAGCATTTGAAGAAGCTGTTCGGAGGGTTTTAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)