Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-XL435m10ex.3                          4 END     2          28       50                (no blast hit)

 This cluster: approximate FL confidence score = 74%

 1012782769 Xl3.1-IMAGE:6631163.5 - 7 ESTs
                                                                       .-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6631163.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTTAGACTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGCTCTGCTCGCTTGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGGAATGACGAAGAACAGAATATCCGGACACTGGTGAACCCCAAAATGGTTCGTAACTCTGCACCTCAACGGCAAGCAAACCGAAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAATTACAAAGTTTTATTGGAATTGAGCTAGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCTTGAGGTGATCCTCAGTGAAGACTCGTGAGTCCAACTGCCTTGCGTGTTATGGATTTGCCTCTTCACCTTTAATTGCAAAGAAGTATTGGATCAAAGGACACTGCTTTGAGGGATTGTCACACGTTCACAGGATTCCCAGCAATTCATCTCTGCTCTCCACAGGGAGATTTTTTTAATTACTACTGGATCACCAACAGCTAAAGCAATGTTATTGCACTAGGATCTCCTTCCTGGCATTATCCATGCCTTACTCTGCATTTTTGTGTTCTCTAACATCATCATATGCTTAAGGAACATCTAACCAGCCCTTTTGCACACTTTCCAAT
                                                  Xl3.1-CHK-1012700134                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGCTCTGCTCGCTTGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGGAATGACGAAGAACAGAATATCCGGACACTGGTGAACCCCAAAATGGTTCGTAACTCTGCACCTCAACGGCAAGCAAACCGAAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAATTACAAAGTTTTATTGGAATTGAGCTAGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCTTGAGGTGATCCTCAGTGAAGACTCGTGAGTCCAACTGCCTTGCGTGTTATGGATTTGCCTCTTCACCTTTAATTGCAAAGAAGTATTGGATCAAAGGACACTGCTTTGAGGGATTGTCACACGTTCACAGGATTCCCAGCAATTCATCTCTGCTCTCCACAGGGAGATTTTTTTAATTACTACTGGATCACCAACAGCTAAAGCAATGTTATTGCACTAGGATCTCCTTCCTGGCATTATCCATGCCTTACTCTGCATTTTTGTGTxxTxxxACATCATCATATGCTTAAGGAACATCTAACxxxCCCTTTTGCACACTTTCCAATCAAGCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   2     4     3     4     4     6     4     6     5     6     5     6     5     6     5     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     7     5     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     6     4     5     4     5     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     2     4     2     4     2     4     2     3     2     3     2     2
                                               BLH ATG      79     111                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN      76      16                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH OVR      79     129                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               CDS MIN      79       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               EST CLI     -12       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 3e-012     NP_038940.1 apelin [Mus musculus] ===================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Bt ==== 1e-012     NP_776928.1 apelin [Bos taurus] =====================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 6e-013     NP_059109.3 apelin preproprotein; peptide ligand for APJ receptor [Homo sapiens] ====================================================================================================================
                                                                       PREDICTED - Cf ---- 3e-014     XP_854262.1 PREDICTED: similar to Apelin precursor (APJ endogenous ligand) [Canis familiaris] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 5e-035     AAI57368.1 Unknown (protein for MGC:147989) [Xenopus tropicalis] ====================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 1e-037     NP_001091393.1 preproapelin-a [Xenopus laevis] ======================================================================================================================================================
                                                 Xl3.1-IMAGE:6631163.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------TAA---------------------------TAG---------------TAA------ATG------ATG------TGA------------TGA------------------------------ATG------------------TAA------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------TAA---------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                               ]
  3  -1   2       bld Ga11                            IMAGE:3474998.3p                                                                                                                                                                                                                                                                                                                                                                                    TGGATCTCCGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCACTTTGGCATTTCTCCATTCCCCGGGGCTCCCTCTGGAAGGAGTTAGACTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGCTCTGCTCGCTTGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGGAATGACGAAGAACAGAATATCCGGACACTGGTGAACCCCAATTTTGTTTCGTAACTCTGCACCTCAACGGCAAGCAAACCGAAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAATTACAAAGTTTTATTGGAATTGAGCTAGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCTTGAGGTGATCCTCAGTGAAGACTCGTGAGTCCAACTGCCTTGCGTGTTATGGATTTGCCTCTTCACCTTTAATTGCA
  5   1   2      seed Emb1 5x3                        IMAGE:6631163.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCCTCTGGAAGGAGTTAGACTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGCTCTGCTCGCTTGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCTCTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGGAATGACGAAGAACAGAATATCCGGACACTGGTGAACCCCAAAATGGTTCGTAACTCTGCACCTCAACGGCAAGCAAACCGAAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAATTACAAAGTTTTATTGGAATTGAGCTAGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCTTGAGGTGATCCTCAGTGAAGACTCGTGAGTCCAACTGCCTTGCGTGTTATGGATTTGCCTCTTCACCTTTAATTGCAAAGAAGTATTGGATCAAAGGACACTGCTTTGAGGGATTGTCACACGTTCACAGGATTCCCAGCAATTCATCTCTGCTCTCCACAGGGAGATTTTTTTAATTACTACTGGATCACCAACAGCTAAAGCAATGTTATTGCACTAGGATCTCCTTCCTGGCATTATCCATGCCTTACTCTGCATTTTGAGTATCTCTAACATCATCATATGCTTAAGGAACATCTAACAGCCCCTTTTGCACACTTTCCAATCAAGCCCTTTTGAGCCTCTAATGAGCCCCaaaaaaaaagtttgcgggaaaaaaaaaaTATTGGGGCCTGAGCAAAAATTTGGGGTCTTAAAACTAAAAAGGAAGGGCTGGGCGGAAAAAATATCCCTGGTTTTCCATAAGGGCTATTTTCCAAACCTTAAAATGGGGTTGGATCCCCCTGGCAACATATTAACCTTATGGGAACATT
  5   1   2       bld Tbd7 5g3  out                        XL096m11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAAGGAGTTAGACTTTCCATACACACAGCTCGCTTCTTGGATTCAGCACAGCTCTGCTCGCTTGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGGAATGACGAAGAACAGAATATCCGGACACTGGTGAACCCCAAAATGGTTCGTAACTCTGCACCTCAACGGCAAGCAAACCGAAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAATTACAAAGTTTTATTGGAATTGAGCTAGTCCCCACCAATTGCATAATCTGCTATGTTTGGCATGGAACCTTGAGGTGATCCTCAGTGAAGACTCGTGAGTCCAACTGCCTTGCGTGTTATGGATTTGCCTCTTCACCTTTAATTGCAAAGAAGTATTGGATCAAAGGACACTGCTTTGAGGGATTGTCACACGTTCACAGGATTCCCAGCAATTCATCTCTGCTCTCCACAGGGAGATTTTTTTAATTACTACTGGATCACCAACAGCTAAAGCAATGTTATTGCACTAGGATCTCCTTCCTGGCATTATCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGCTTAAGGAACATCTAACAGCCCTTTTGCACACT
  5   1   2       bld Gas5 5x3                        IMAGE:3747628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGAGTTAGACTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGCTCTGCTCGCTTGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGGAATGACGAAGAACAGAATATCCGGACACTGGTGAACCCCAAAATGGTTCGTAACTCTGCACCTCAACGGCAAGCAAACCGAAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAATTACAAAGTTTTATTGGAATTGAGCTAGTCCCCACCAATTGCATAATCTGCTATGTTTGGCATGGAACCTTGAGGTGATCCTCAGTGAAGACTCGTGAGTCCAACTGCCTTGCGTGTTATGGATTTGCCTCTTCACCTTTAATTGCAAAGAAGTATTGGATCA
  5   1   2       bld Neu7 5x3                             XL005a15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACACACAAACAGCTCGCTTCTTGGATTNGGACAACTCTGCTCGCTCTCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCACTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGGAATGATGAAGAACAGAATATCCGGACACTGGTGAACCCAAAAATGGTCCGTAACTCTGCACCTCAACGGCAAGCCAACCGGAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAAATAAAAAGGTAACAGAGTACAGTAAATATGTTGCTGCCTGTACTAATTATTACTCTTAAATGATAAAAGGCTGTCACCCAACCATTCTTCTTGATCTGACATTGACATACAGTATGTTAAAAATGTAACCTGTCTTATCTTAAAAGTACATACAATTCCATTACTCTCTGCACCTTTCTATTTACTCTGAGCAGTAAAGAAAGAATTCCAATGTATTTTTTTCTAGCTGTTTGAAAAGCAGCACATTCCATTGAAGACATTCAGTAAATGAACCTTCAGTATACATTCA
  5   1   2       bld Neu7 5g3  out                        XL045f04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACACACAGCTCGCTTCTTGGATTCAGCACAGCTCTGCTCGCTTGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCTCTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGGAATGACGAAGAACAGAATATCCGGACACTGGTGAACCCCAAAATGGTTCGTAACTCTGCACCTCAACGGCAAGCAAACCGAAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAATTACAAAGTTTTATTGGAATTGAGCTAGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCTTGAGGTGATCCTCAGTGAAGACTCGTGAGTCCAACTGCCTTGCGTGTTATGGATTTGCCTCTTCACCTTTAATTGCAAAGAAGTATTGGATCAAAGGACACTGCTTTGAGGGATTGTCACACGTTCACAGGATTCCCAGCAATTCATCTCTGCTCTCCACAGGGAGATTTTTTTAATTACTACTGGATCACCAACAGCTAAAGCAATGTTATTGCACTAGGATCTCCTTCCTGGCATTATCCATGCCTTACTCTGCATTTTTGTGTATCTCTAACATCATCATATGCATAAGGA
  5   1   2       bld Brn1                            IMAGE:6956160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATGGTCCGTAACTCTGTACCTCAACGGCAAGCCAACCNGGAGAAAACTCATACGTCAAAGACCCCGTCTTTCACACAAGGGCCCAATGCCCTTCTAAAAATAAAAAGTTTTATTGGAATTGAGCCAACCTTCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGAGGTGATCCTCaagagagaggaagagagagGACCCATGAGTCCAGCTGCCTTGCATTTTATAGATTTGCCTCTTCACCTTTAAAAGAAGTATTGGATTAAAGGACACTGCTTTGAGGAATTGCCATGTGTTACCAGGATTCCCAGCAATTCATCTCTGCTCTCCACAGGGAGATCTTTTTAATTACTACTGGATCACAAACAGCTAAAGCAATGTTATTGCACTAGGATCGCCTTTCTGGCATTGTCCATACCTTACTCTGCATTTTTGTGTATTTCTAACATCTTCATATGCTTTAGGAACGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCCTTCAAGCTTCTAATGAGCCAAAAAATAGTTTGTGGTAAAAAAATGTTGGTGCTGAACAGAATTTGTGTTCCATTGGGGCATATCTTATTATGGACATATAATGATGCTTTAAGGCTCTATCTAAGCCCCTTGCCTGTGGCATCTACCTGTACAAttttgtttttcttttttAGGGAAAAAAAGTATTAATGAATAAAGCCATCCAAATAGCACTTTCCTTAACATACATGCTTTAACGGGTTCATTTCATGAAAGCTAAAAGAAAACAAATTACAGTATTGTGTTAAttttttttGTATTGCTCTTTCCTCTTCCTTAAACAAATGTTTCTCTATCTGTTtatgtatatatatatatgtatatGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)