Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7978240.5                       4 END     1          11       25                SRY (sex determining region Y)-box 9 (campomelic dysplasia, autosomal sex-reversal) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6948454.3                       4 PI      86          1      378                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012782798 Xl3.1-XL449e07ex.5 - 9 ESTs
                                                                       ........-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL449e07ex.5                                                                                         GAAAGAGCATCAAGGAGGAGATTCGCCAATGGTACATTACGAATGTAGGAAATATTTTTCCATATAGATATATACCCAAGTGCCAACAACCAAGTTGCCTAAAAACAAGTGCCCTTTTTTACCTCCCATATCCAGCAGTTACAACTTGACAATTTTGCCTTAGATAAAATCACCTGCAGATTTTTACTCAAGATTTTTTTAAATTCCTAAATTATTTATTTTGTATAAAAGCTAACATGTAAAAAAAATGCTTATTGATATCCCTGCTCCTTCCCATGACTTAAATATTTTAGCATGTTCTTCCAAACTCGGAAACTGCAACATTTTATTTTTTTGTTAAATTATGGATTATGCCGTTTCTCCTTTCTGTTATATTCCGTTCTAAATTTCTTATTGCAAGCCCTGTTTAAAAAAAAAATAGAGTAGAAAAAGCTGCCTTTTTTTTTACATATGAAAACAATCTAATAGCATTATGAATCATTTTTGAGCTGAGAAAAATATATTAATTTATACCGAAATCCTTACTTAAAATATATAGAAAAAAACCACCTCGGTGCTAATTAGACAATACGGCGAGCAATAACTTGTCATATAAAGTGCAGTCTGACTAGTGAAGTTTTAACCCTTGCTTCAAAATTGGTATTATTTTTGTATATTTTTAGATCCAATGAAGCACTCCTTAATTATTGCTTTTGTTACAAAAAAAAGCAGGCCTTAAATATTTCTTTAACTTAAACAAAAAGGATATACGATGTTTGTTAGTCGCTGGATTTTTTGTAAATTGTATTGTGTAACTTTTTTTGACAGTTTCTATGTTTTGTGTCTTTTGTGAAACTTACCCTCTTGTGTATTATTTTGCAATAAATATACCATGTA
                                                  Xl3.1-CHK-1012697126                                                                                               GCATCAAGGAGGAGATTCGCCAATGGTACATTACGAATGTAGGAAATATTTTTCCATATAGATATATACCCAAGTGCCAACAACCAAGTTGCCTAAAAACAAGTGCCCTTTTTTACCTCCCATATCCAGCAGTTACAACTTGACAATTTTGCCTTAGATAAAATCACCTGCAGATTTTTACTCAAGATTTTTTTAAATTCCTAAATTATTTATTTTGTATAAAAGCTAACATGTAAAAAAAATGCTTATTGATATCCCTGCTCCTTCCCATGACTTAAATATTTTAGCATGTTCTTCCAAACTCGGAAACTGCAACATTTTATTTTTTTGTTAAATTATGGATTATGCCGTTTCTCCTTTCTGTTATATTCCGTTCTAAATTTCTTATTGCAAGCCCTGTTTAAAAAAAAAATAGAGTAGAAAAAGCTGCCTTTTTTTTTACATATGAAAACAATCTAATAGCATTATGAATCATTTTTGAGCTGAGAAAAATATATTAATTTATACCGAAATCCTTACTTAAAATATATAGAAAAAAACCACCTCGGTGCTAATTAGACAATACGGCGAGCAATAACTTGTCATATAAAGTGCAGTCTGACTAGTGAAGTTTTAACCCTTGCTTCAAAATTGGTATTATTTTTGTATATTTTTAGATCCAATGAAGCACTCCTTAATTATTGCTTTTGTTACAAAAAAAAGCAGGCCTTAAATATTTCTTTAACTTAAACAAAAAGGATATACGATGTTTGTTAGTCGCTGGATTTTTTGTAAATTGTATTGTGTAACTTTTTTTGACAGTTTCTATGTTTTGTGTCTTTTGTGAAACTTACCCTCTTGTGTATTATTTTGCAATAAATATAC
                                                      consensus depths                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     3     5     3     6     4     7     4     7     5     7     4     7     3     8     3     8     4     8     3     8     4     8     4     8     4     8     4     8     6     8     6     8     6     8     6     8     6     8     7     8     6     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     4     5     3     4
                                                    Xl3.1-XL449e07ex.5                                                                                                                                   ATGTAG---------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TAA---------------TAA---------------------------TGA------------------TGA---------------ATG------------------------------------------------------------------------------------------------------------------------------TAG------------------------ATG---------TAATAG---------------------TGA---------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAG---------------TAA---------------------TGA---------------------------------------------------------TAA
  5   1   2       bld Emb4      in                    IMAGE:4957283.5p TTCAAATAGAACATTTATTTTGAATTACACAAAAAACTTGAAATCTGTGTTATCCAGACAAGCTTCTAAGAAGCAACTAGAAGGATCCGAAAGAGCATCAAGGAGGAGATTCGCCAATGGTACATTACGAATGTAGGAAATATTTTTCCATATAGATATATACCCAAGTGCCAACAACCAAGTTGCCTAAAAACAAGTGCCCTTTTTTACCTCCCATATCCAGCAGTTACAACTTGACAATTTTGCCTTAGATAAAATCACCTGCAGatttttactcaagatttttttaaattcctaaattatttattttgtataaaagctaacatgtaaaaaaaaTGCTTATTGATATCCCTGCTCCTTCCCATGACTTAAATATTTTAGCATGTTCTTCCAAACTCGGAAACTGCAACAttttatttttttGTTAAATTATGGATTATGCCGTTTCTCCTTTCTGTTATATTCCGT
  5   1   2       bld Emb4                   IMAGE:4957283-IMAGp.IMAGp                                                                                         GAAAGAGCATCAAGTAGGAGATTCGCCAATGGTACATTACGAATGTAGGAAATATTTTTCCATATAGATATATACCCAAGTGCCAACAACCAAGTTGCCTAAAAACAAGTGCCCTTTTTTACCACCCATATCCAGCAGTTACAACTTGACAATTTTGCCTTAGATAAAATCACCTGCAGatttttactcaagatttttttaaattcctaaattatttattttgtataaaagctaacatgtaaaaaaaaTGCTTATTGATATCCCTGCTCCTTCCCATGACTTAAATATTTTAGCATGTTCTTCCAAACTCGGAAACTGCAACAttttatttttttGTTAAATTATGGATTATGCCGTTTCTCCTTTCTGTTATATTCCGTTCTAAATTTCTTATTGCAAGCCCTGTTTaaaaaaaaaatagagtagaaaaagctgcctttttttttACATATGAAAACAATCTAATAGCATTATGAATCATTTTTGAGCTGAGAAAAATATATTAATTTATACCGAAATCCTTACTTAAAATATATAGAAAAAAACCACCTCGGTGCTAATTAGACAATACGGCGAGCAATAACTTGTCATATAAAGTGCAGTCTGACTAGTGAAGTTTTAACCCTTGCTTCAAAATTGGTATTATTTTTGTATATTTTTAGA
  5   1   2      skin Ga15      in                       XL449e07ex.5p                                                                                                                                                                                                                                                                                                                           CTCCGCTAACATGTaaaaaaaaTGCTTATTGATATCCCTGCTCCTTCCCATGACTTAAATATTTTAGCATGTTCTTCCAAACTCGGAAACTGCAACAttttatttttttGTTAAATTATGGATTATGCCGTTTCTCCTTTCTGTTATATTCCGTTCTAAATTTCTTATTGCAAGCCCTGTTTaaaaaaaaaaatagagnanaaaaagcngcctttttttttACATATGAAAACAATCTAATAGCATTATGAATCATTTTTGAGCTGANAAAAATATATTAATTTATACCGAAATCCTTACTTAAAATATATAGAAAAAAACCACCTCGGGGCTAATTANACAATACGGNGAGCAATAACTNGTCATATAAAGGGCAGTCNGACTAGGGAAGTTTTAACCCTNGCTTCAAAATNGGNATTATTTTNGTATATTTTTANATCCAANGAAGCACNCCTTAATTATNGCTTTNGTTACaaaaaaaaGCAGGCCTTAAATATTTCTTTAACTTAAACAAAAAGGATATACGANGTTNGTTAGNCNCNGGATTTTTTGTAAATNGNATNGGGNAACTTTTTTNGACAGTTNCTANGTTTNGGGNCTTTNGGGAAACTTACCCTCTNGGGNATTATTTTGCAATAAATATNCCANGNACTaaaaaaaaaa
  3   1   2       bld Tbd7 5g3  out                        XL094d15.3p                                                                                                                                                                                                                                                                                                                                                                     GCTCCTTCCCATGACTTAAATATTTTAGCATGTTCTTCCAAACTCGGAAACTGCAACATTTTATTTTTTTGTTAAATTATGGATTATGCCGTTTCTCCTTTCTGTTATATTCCGTTCTAAATTTCTTATTGCAAGCCCTGTTTAAAAAAATAGAGTAGAAAAAGCTGCATTTTTTTTACACATGAAAACAATCTAATAGCATTATGAATCATTTTTGAGCTGAGAAAAATATATTAATTTATACCGAAATCCTTACTTAAAATATATAGAAAAAAAACCACCTCGGTGCTAATTAGACAATACGGCGAGCAATAACTTGTCATATAAAGTGCAGTCTGATTAGTGAAGTTTTAACCCTTGCTTCAAAATTGGTATTATTTTTGTATATTTTTAGATCCAATGAAGCACTCCTTAATTATTGCTTTTGTTACAAAAAAAAGCAGGCCTTAAATATTTCTTTAACTTAAACAAAAAGGATATACGATGTTTGTTAGTCGCTGGATTTTTTGTAAATTGTATTGTGTAACTTTTTTTGACAGTTTCTATGTTTTGTGTCTTTTGTGAAACTTACCCTCTTGTGTATTATTTTGC
  3   1   2      seed Emb4      in                    IMAGE:4957283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTGTTAAATTATGGATTATGCCGTTTCTCCTTTCTGTTATATTCCGTTCTAAATTTCTTATTGCAAGCCCTGTTTAAAAAAAAAATAGAGTAGAAAAAGCTGCCTTTTTTTTTACATATGAAAACAATCTAATAGCATTATGAATCATTTTTGAGCTGAGAAAAATATATTAATTTATACCGAAATCCTTACTTAAAATATATAGAAAAAAACCACCTCGGTGCTAATTAGACAATACGGCGAGCAATAACTTGTCATATAAAGTGCAGTCTGACTAGTGAAGTTTTAACCCTTGCTTCAAAATTGGTATTATTTTTGTATATTTTTAGATCCAATGAAGCACTCCTTAATTATTGCTTTTGTTACAAAAAAAAGCAGGCCTTAAATATTTCTTTAACTTAAACAAAAAGGATATACGATGTTTGTTAGTCGCTGGATTTTTTGTAAATTGTATTGTGTAACTTTTTTTGACAGTTTCTATGTTTTGTGTCTTTTGTGAAACTTACCCTCTTGTGTATTATTTTGCAATAAATATACCATGTACTA
  5  -1   2       bld Emb1                   IMAGE:3403113-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCTGGATAACACAGTAAAAGGCCAGATTCAGTTCTTCAAAATAAATGTTTTATTTGAATTACACAAAAAACTTGAAATCGCAAGAAAAGCTGGAGATTTCTGCTTGTTCAGCGTTCGAAGGGAAAAAATTAAGAAtttttttttttCATACAAAAAGTTGTTTAAAATATAAATGTAAAAACCACCTCGGTGCTAATTAAACAATACGGCGAGCAATAACTTGTCATATAAAGTGCAGTCTGACTAGTGAAGTTTTAACCCTTGCTTCAAAATTGGTATTATTTTTGTATATTTTTAGATCCAATGAAGCACTCCTTAATTATTGCTTTTGTTACaaaaaaaaGCAGGCCTTAAATATTTCTTTAACTTAAACAAAAAGGATATACGATGTTTGTTAGTCGCTGGATTTTTTGTAAATTGTATTGTGTAACTTTTTTTGACAGTTTCTATGTTTTGTGTCTTTTGTGAAACTTACCCTCTTGTGTATTATTTTGCAATAAATATACCATGTACT
  3   1   2       add Ga15      in                       XL449e07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGNTTNAAANTTNTTNTTGCNAGCCCTGTTTAAAAAAAANAATAGAGTAGANAAAGCNGCCTTTTTTTNTACATANGANANCAATCTNATAGCATTATGAATCATNTNTGNGCNGAGAAAAATATATTAATTTATACCGAAATCCTTACNTAAAATATATAGAAAAAAACCCCCTCGGTGNTAATNAGACCATNCGGCGAGCNATANCTTGTCATANAAAGTGCAGTCTGACTAGTGAAGTNTTNACCCTTGCTTCAAAATTGGTANTATTTTNGTATATTTTTAGATCCAANGAAGCACTCCNTAATTATTGCTTTNGTTACAAAAAAAAGCAGGCCTTAAATATTTCTTTAACTTNAACAAAAAGGATATACGATGTTTGTTAGTCGCTGGATTTNTTGTAAATTGTATTGTGTAACTTTTTTTGACAGTTTCTATGT
  3   1   2       bld Tbd7                                 XL071i13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTNTTATTGCAAGCCCTGTTTAAAAAAAAAATAGAGTAGAAAAAGCTGCCTTTTTTTTTACATATGAAAACAATCTAATAGCATTATGAATCATTTTTGAGCTGAGAAAAATATATTAATTTATACCGAAATCCTTACTTAAAATATATAGAAAAAAACCACCTCGGTGCTAATTAGACAATACGGCGAGCAATAACTTGTCATATAAAGTGCAGTCTGACTAGTGAAGTTTTAACCCTTGCTTCAAAATTGGTATTATTTTTGTATATTTTTAGATCCAATGAAGCACTCCTTAATTATTGCTTTTGTTACAAAAAAAAGCAGGCCTTAAATATTTCTTTAACTTAAACAAAAAGGATATACGATGTTTGTTAGTCGCTGGATTTTTTGTAAATTGTATTGTGTAACTTTTTTTGACAGTTTCTATGTTTTGTGTCTTTTGTNAAACTTACCCTCTTGTGTATTATTTTGCAATAAATATA
  5  -1   2       bld Emb1                            IMAGE:3403088.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAAGAAAAGCTGGAGAATTCTACTTGTTCAGCGNTGGAAGGGAAAAAATTAAGAAtttttttttttcaaacaaaaagttgtctaaaagaaaaatgtaaaaaccACCCNGGTGCTAATTAGACAAAACGGCGAGCAATAACTTGTCAAATAAAGNGCAGTCTGACTAGTGAAGTTTTAACCCTTGCTTCAAAATTGGTATTATTTTTGTATATTTTTAGATCCAATGAAGCACTCCTTAATTATTGCTTTTGTTACaaaaaaaaGCAGGCCTTAAATATTTCTTTAACTTAAACAAAAAGGATATACGATGTTTGTTAGTCGATGGATTTTTTGTAAATTGTATTGTGTAACTTTTTTTGACAGTTTCTATGTTTTGTGTCTTTTGTGAAACTTACCCTCTTGTGTATTATTTTGCAATAAATATACCATGTACT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)