Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-IMAGE:6864414.5                       3 END     1           9       33                MGC83327 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6864414.5                       3 PI      92          9      430                MGC83327 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012782844 Xl3.1-IMAGE:4756924-IMAGp.5 - 11 ESTs
                                                                       ..-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4756924-IMAGp.5                                                                         CAGACCCAGCAGCAGCAGCAGCAGCATGGCCGCCTGATCAGCTTCCCAGAGCCCCCAATGCAGCCAGAGCGCAGCCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCTCCATCCGAGCCAGTGAGTTCCAGAGCATGATGCACCACCCTTCCCAGGATTCCCCCACTCTGCCCGAATCCACGGCCACTGACTCTGGCTACTACAGCCCGGGAGCAGCCGCTGGCCACCCTCACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTGAATGCGTATCAGTACCAGTACCATGGCATGAATGGAGCAGCTGCAAACTACTCTGGCAAAGCCTACAGCGACTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTATAACAGGGTGCAGCCCCCCAGCACTCAGCCAGAGAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTAAATGGAAAACCGAAGAAAATCCGAAAACCGCGCACCATCTACTCCAGCTTTCAACTCGCAGCGTTACAAAGACGCTTCCAGAAGACGCAGTACTTGGCGCTGCCGGAACGCGCAGAACTGGCGGCATCGCTGGGACTAACGCAAACACAGGTAAAAATATGGTTTCAGAATAAAAGATCCAAAATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGTCCCAGTTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTGGTGTGGGAACCCCAAGGATCCTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGCCCTCCAGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCGGGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGCCACCTGGGCTTCTTTTTGTCTTTTTATTTTTGGACTATCATTTTTTCATTGTTAAGGAGTCATACAAACCAATGCATAAGATGGATTTTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTTCAATGTTTATTTTAACCGTGTAAATACATGTAGATAGAGGAATTAAACTGTATA
                                                  Xl3.1-CHK-1012694485                                                                               CAGCAGCAGCAGCAGCAGCATGGCCGCCTGATCAGCTTCCCAGAGCCCCCAATGCAGCCAGAGCGCAGCCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCTCCATCCGAGCCAGTGAGTTCCAGAGCATGATGCACCACCCTTCCCAGGATTCCCCCACTCTGCCCGAATCCACGGCCACTGACTCTGGCTACTACAGCCCGGGAGCAGCCGCTGGCCACCCTCACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTGAATGCGTATCAGTACCAGTACCATGGCATGAATGGAGCAGCTGCAAACTACTCTGGCAAAGCCTACAGCGACTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTATAACAGGGTGCAGCCCCCCAGCACTCAGCCAGAGAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTAAATGGAAAACCGAAGAAAATCCGAAAACCGCGCACCATCTACTCCAGCTTTCAACTCGCAGCGTTACAAAGACGCTTCCAGAAGACGCAGTACTTGGCGCTGCCGGAACGCGCAGAACTGGCGGCATCGCTGGGACTAACGCAAACACAGGTAAAAATATGGTTTCAGAATAAAAGATCCAAAATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGTCCCAGTTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTGGTGTGGGAACCCCAAGGATCCTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGCCCTCCAGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCGGGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGCCACCTGGGCTTCTTTTTGTCTTTTTATTTTTGGACTATCATTTTTTCATTGTTAAGGAGTCATACAAACCAATGCATAAGATGGATTTTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTTCAATGTTTATTTTAACCGTGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGG
                                                      consensus depths                                                                              2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     5     5     5     5     5     5     5     5     3     6     4     6     3     5     3     5     3     5     3     5     3     5     4     5     5     6     5     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     5     6     4     6     5     6     5     6     5     6     4     6     5     6     5     6     5     6     4     6     4     6     5     6     5     5     5     5     5     5     5     5     5     5     3     5     3     5     3     5     2     5     3     4     2     3
                                               BLH ATG      57     976                                                                         
                                               BLH MIN      57     129                                                                         
                                               BLH MPR      36     129                                                                         
                                               BLH OVR      57     247                                                                         
                                               CDS MIN      57     129                                                                         
                                               ORF LNG      57      12                                                                         
  5   1   2       bld Ga15 5g3  in                       XL456n02ex.5p CcctcctctctctctcctcctcctcctcACTGATCACTAAGGATCCTTCCCAAGAGCTCACTATTTCAGTGGCAGACCcagcagcagcagcagcagcaTGGCCGCCTGATCAGCTTCCCAGAGCCCCCAATGCAGCCAGAGCGCAGCCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCTCCATCCGAGCCAGTGAGTTCCAGAGCATGATGCACCACCCTTCCCAGGATTCCCCGACTCTGCCCGAATCCACGGCCACTGACTCTGGCTACTACAGCCCGGGAGCAGCCGCTGGCCACCCTCACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTGAATGCGTATCAGTACCAGTACCATGGCATGAATGGAGCAGCTGCAAACTACTCTGGCAAAGCCTACAGCGACTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTATAACAGGGTGCAGCCCCCCAGCACTCAGCCAGAGAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTAAATGGAAAACCGAAGAAAATACGAAAACCGCGCACCATCTACTCCAGCTTTCAACTCGCAGCGTTACAAAGACGCTTCCAGAAGACGCAGTACTTGGCGCTGCCGGAACGCGCAGAACTGGCGGCATCGCTGGGACTAACGCAAACACAGGTAAAAATATGGTTTCAGAATAAAAGATCCAAAATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGTCCCAGTTCCAGTGACCCCAT
  5   1   2      seed Eye1 5g                IMAGE:4756924-IMAGp.IMAGp                                                                         CAGACCcagcagcagcagcagcagcaTGGCCGCCTGATCAGCTTCCCAGAGCCCCCAATGCAGCCAGAGCGCAGCCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCTCCATCCGAGCCAGTGAGTTCCAGAGCATGATGCACCACCCTTCCCAGGATTCCCCCACTCTGCCCGAATCCACGGCCACTGACTCTGGCTACTACAGCCCGGGAGCAGCCGCTGGCCACCCTCACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTGAATGCGTATCAGTACCAGTACCATGGCATGAATGGAGCAGCTGCAAACTACTCTGGCAAAGCCTACAGCGACTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTATAACAGGGTGCAGCCCCCCAGCACTCAGCCAGAGAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTAAATGGAAAACCGAAGAAAATCCGAAAACCGCGCACGATCTACTCCAGCTTTCAACTCGCAGCATTACAAAGACGCTTCCAGAAGACGCAGTACTTGGCGCTGCCGGAACGCGCAGAACTGGCGGCATCGCTGGGACTAACGCAAACACAGGTAAAAATATGGTTTCAGAATAAAAGATCCAAAATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGTCCCAGTTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTGGTGTGGGAACCCCAAGGATCCTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCC
  5   1   2       bld Ga15 5g3  in                       XL461h20ex.5p                                                                             CCcagcagcagcagcagcaNCATGGCCGCCTGATCAGCTTCCCAGAGCCCCCAATGCAGCCAGAGCGCAGCCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCTCCATCCGAGCCAGTGAGTTTCAGAGCATGATGCACCACCCTTCCCAGGATTCCCCGACTCTGCCCGAATCCACGGCCACTGACTCTGGCTACTACAGCCCGGGAGCAGCCGCTGGCCACCCTCACCATGGCTACTGTTCGCCCACTTCGGCCACTTATGGAAAGGCGCTGAATGCGTATCAGTACCAGTACCATGGCATGAATGGAGCAGCTGCAAACTACTCTGGCAAAGCCTACAGCGACTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTATAACAGGGTGCAGCCCCCCAGCACTCAGCCAGAGAAAGAAGTATCANAGCCCGAGGTGAGAATGGTAAATGGAAAACCGAAGAAAATCCGAAAACCGCGCACCATCTACTCCAGCTTTCAACTCGCAGCGTTACAAAGACGCTTCCAGAAGACGCAGTACTTGGCGCTGCCGGAACGCGCAGAACTGGCGGNATCGCTGGGACTAA
  5   1   2       bld Brn1 5g                         IMAGE:6953843.5p                                                                                  cagcagcagcagcagcaTGGCCGCCTGATCAGCTTCCCAGAGCCCCCAATGCAGCCAGAGCGCAGCCCCCAGAGCATGACAGGAGTCTATGAGCGGAGAGTCGCCTCCATCCGAGCCAGTGAGTTCCAGAGCATGATGCACCACCCTTCCCAGGATTCCCCCACTCTGCCCGAATCCACGGCCACTGACTCTGGCTACTACAGCCCGGGAGCAGCCGCTGGCCACCCTCACCATGGCTACTGTTCGCCCACTACGGCCACTTATGGAAAGGCGCTGAATGCGTATCAGTACCAGTACCATGGCATGAATGGAGCAGCTGCAAACTACTCTGGCAAAGCCTACAGCGACTATGGCTATGGGAGCCCTTACCACCCTCACCACCAGTACAGCGGAGCGTATAACAGGGTGCAGCCCCCCAGCACTCAGCCAGAGAAAGAAGTATCAGAGCCCGAGGTGAGAATGGTAAATGGAAAACCGAAGAAAATCCGAAAACCGCGCACCATCTACTCCAGCTTTCAACTCGCAGCATTACAAAGACGCTTCCAGAAGACGCAGTACTTGGCGCTGCCGGAACGCGCAGAACTGGCGGCATCGCTGGGACTAACGCAAACACAGGTAAAAATATGGTTTCAGAATAAAAGATCCAAAATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGTCCCCAGTTCCAAGTGACCCCCATGGCGGTGTAATTTCTCCCCAGGTCTCCCAGTGGGTGTGGGGAACCCCCCAAGGATTCCTCCAAGGGTCCACTCAAGCCAccccccccccatggtaaatttcccaaccccccaggccctccaagcgagcttccccccgggcgatcctccccTAC
  5   1   2       add Eye1      in                    IMAGE:4756924.5p                                                                                                                                                               GACAGGAGTCTATGAGCGGAGAGTCGCCTCCATCCGAGCCAGTGAGTTCCAGAGCATGATGCACCACCCTTCCCAGGATTCCCCCACTCTGCCCGAATCCACGGCCACTGACTCTGGCTACTACAGCCCGGGAGCAGGCGCTGGCCACCCTCACCATGGCTACTGCTCGCCCACTCCGGTCACTTATGCAAACGCCCTG
  5   1   2       bld Brn3                            IMAGE:8539804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCTACTCCAGCTTTCAACTCGCAGCGTTACAAAGACGCTTCCAGAAGACGCAGTACTTGGCGCTGCCGGAACGCGCAGAACTGGCGGCATCGCTGGGACTAACGCAAACACAGGTAAAAATATGGTTTCAGAATAAAAGATCCAAAATTAAGAAAATCATGAAGAACGGAGAGCTGCCTCCAGAACACAGTCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTGGTGTGGGAACCCCAAGGATCCTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGCCCTCCAGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCGGGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGCCACCTGGGCTTctttttgtctttttatttttggactatcattttttCATTGTTAAGGAGTCATACAAACCAATGCATAAGATGGAttttttttAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCAtttttttccagagacttttttttncatgtttattttAACCCGTGTAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGGATAATAAATTATTNNCGACAGAAAAA
  3   1   2       bld Ga15 5g3  in                       XL456n02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAATAAAAGATCCAAAATTAAGAAAATCANGAAGAACGGAGAGCTGCNTCCAGAACNCAGTCCCAGTTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTNTCCAGTGGTGTGGGAACCCCAAGGATCNTCAAGGTCACTCAGCCACCACCCCCATGTACATTCCCACCCCCAGCCCTCCAGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCGGGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGCCACCTGGGCTTCTTTTTGTCTTTTTATTTTTGGACTATCATTTTTTCATTGTTAAGGAGTCATACAAACCAATGCATAAGATGGATTTTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCCAGAGACTTTTTTTTCAATGTTTATTTTAACCGTGTAAATACATGTAGATAGAGGAATTAAACTGTA
  3   1   2      shim Ga12      out                        XL159o04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCCAGAACACAGTCCCAGCTCCAGTGACCCCATGGCGTGTAATTCTCCCCAGTCTCCAGTGGTGTGGGAACCCCAAGGATCCTCAAGGTCACTCAAGCCACCACCCCCATGTACATTCCCACCCCCAGCCCTCCAGCAGCTCCCCTGCATCCTCCTATCTGGAGAACTCGGGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAGCCACCTGGGCTTCTTTTTGTCTTTTTATTTTTGGACTATCATTTTTTCATTGTTAAGGAGTCATACAAACCAATGCATAAGATGGATTTTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTGCCAGAGACTTTTTTTTCAATGTTTATTTTAACCGTGTAAATACATGTAGCATAGNAGGGAATTAAGACTGTAT
  3   1   2       bld Eye1      in                    IMAGE:4756924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCATGTACATTCCCACCCCCAGCCCTCCAGCAGTTCCCCTGCATCCTCCTATTTGGAGAACTCGGGCGTCTGGTACCCTACAGGCACCCACCTGCAGAACCTGCAGAACCATGCCTCTTTACAGCACCCCTTGGCCTTGGCATCAGGGACTCTCTACTAAAAACCACCTGGGCTTCTTTTTGTCTTTTTATTTTTGGACTATCATTTTTTCATTGTTAAGGAGTCATACAAACCAATGCATAAGATGGATTTTTTTTAAGGCAAAGTATATTGTGTAAAGCTTGTTGCATGTAACTTATTGCATTTCAAAGGAGACCGTGTGTTTTTTACAGATTGTCTTTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATTTATGACCTCATTTTTTTCCAGAGACTTTTTTTTCAATGTTTATTTTAACCGTGTAAATACATGTAGATAGAGGAATTAAACTGTATATTCTGGATAAATAAAATTATTTCGGCCCGGAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Ga15                               XL423a20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCCCCTTTTTTTTTTTTTTTTTTTTTTTTTGGACTATCATTTTTTTCCCATTGTTAAGGAGTCATACAAACCAATGCATAAGATGGATTTTTTTTAAAGGCAAAGTATATTGTGTAAAGTTTGTTGCATGTAACTTATTGCATTTCAAAGGAGTGTTTTTTATACAGATTGTCATTGCGCAACTGGGGACACTATCTCAATGGTGCCTTGAATCTATGACCTCATTTTTTTCTCCCAGAGACCTTTTTTTCCAATGTTTATTTTANCCGTGTAAATA
  3   1   2       add Ga15 5g3  in                       XL461h20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTNGTCNTTNTANTTGNGGACTATCANNTNTTCATTGTTAAGGAGTCATACAAACCAATGCATAAGATGGATNTTTNTTAAGGCAAAGTATATCGTGTAAAGCTTGTTGCATGTAAGCTTATTGCATTTCAAAGGAGAGCCGTGTGTTTTTTACAGATTGTCTTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)