Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 88%

 1012782849 Xl3.1-IMAGE:7768291.5 - 8 ESTs
                                                                       -160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7768291.5                                                                                                                                                                 CACATTCCTTTACTTGAAATTAGCGCAACGTTCTCGCAAGCTGCAAACCTATCAAATCGCCGTATTAATGATGGACAGCCCGGTAAACCAATCAGTGACCAGTCCTCTTTGAGTAGAACGAGGACCCGCTATAACAGAAGCTGAGGAGGTGTGTTTGAATGGCAGCCCTTTTGTCCAATAGCCCGTTGTCTCGTTGAGGGCGGGCTTCTGTCTGCGGCTATGCAGACTACGCATTCACGCAATAAAGAGGCAGATTCTGGAAACCGTTACGCTGCGTAGGTTTCGTTTCTCCCGTCCTTCCCAGATTACGCAATTTACGTATAAAGGCCTATTCCACATCGCTGGCTAAGGGCCATGGCTACGCCAGCCAAGAAGCGTAAAATGAACTTTTCTGAGCAAGAAGTGGAGATCATCCTGGAAGAGATGGAGAAGCAGAAGCACATCCTCATTAACCACTTCAATGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACATCCTGAAGCGCGTCAATGCCATCAGCACGTGCCACCGTGAGCTGGCCGAGGTCAAGAAGAAGTGGTCTGATCTGAAGACTGAGGTGCGAAGAAAGATGTCGCAGGCACGGTTGGCGGTGGAAGGTGAAGGCGATGTGGGCACGGCCCCGGTCATGCTCACCCCCATGCAGCAGCGCATATGTAACTTGCTGGGCGAGAGCGCAATACTAACCCTTCCGTCCGACATACCTGGCCAAGTGGGGATCAACTCGCCTGGCAGCATGGCCTTGTCCCAAATTGCACCAGAGACAACGTTTCACGCCCTAGAAGAGAATGTGGTGGAGTACTGCACCACAGAGACAGCTACAACGGTAACCACAGATGCCCCCGTAGGAATCATATCTCCTTCTCATGAAGTCTCTGTAAAA
                                                  Xl3.1-CHK-1012697734                                                                                                                                                                       CCTTTACTTGAAATTAGCGCAACGTTCTCGCAAGCTGCAAACCTATCAAATCGCCGTATTAATGATGGACAGCCCGGTAAACCAATCAGTGACCAGTCCTCTTTGAGTAGAACGAGGACCCGCTATAACAGAAGCTGAGGAGGTGTGTTTGAATGGCAGCCCTTTTGTCCAATAGCCCGTTGTCTCGTTGAGGGCGGGCTTCTGTCTGCGGCTATGCAGACTACGCATTCACGCAATAAAGAGGCAGATTCTGGAAACCGTTACGCTGCGTAGGTTTCGTTTCTCCCGTCCTTCCCAGATTACGCAATTTACGTATAAAGGCCTATTCCACATCGCTGGCTAAGGGCCATGGCTACGCCAGCCAAGAAGCGTAAAATGAACTTTTCTGAGCAAGAAGTGGAGATCATCCTGGAAGAGATGGAGAAGCAGAAGCACATCCTCATTAACCACTTCAATGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACATCCTGAAGCGCGTCAATGCCATCAGCACGTGCCACCGTGAGCTGGCCGAGGTCAAGAAGAAGTGGTCTGATCTGAAGACTGAGGTGCGAAGAAAGATGTCGCAGGCACGGTTGGCGGTGGAAGGTGAAGGCGATGTGGGCACGGCCCCGGTCATGCTCACCCCCATGCAGCAGCGCATATGTAACTTGCTGGGCGAGAGCGCAATACTAACCCTTCCGTCCGACATACCTGGCCAAGTGGGGATCAACTCGCCTGGCAGCATGGCCTTGTCCCAAATTGCACCAGAGACAACGTTTCACGCCCTAGAAGAGAATGTGGTGGAGTACTGCACCACAGAGACAGCTACAACGGTAACCACAGATGCCCCCGTAGGAATCATATCTCCTTCTCATGAAGTCTCTGTAAAACCCCAA
                                                      consensus depths                                                                                                                                                                      3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     3     5     3     5     3     5     3     6     4     6     4     6     5     7     5     7     6     7     5     7     4     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     5     7     5     6     4     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     354     159                                                                                                                                                                 
                                               BLH MIN     354      59                                                                                                                                                                 
                                               BLH MPR     342      59                                                                                                                                                                 
                                               BLH OVR     354     109                                                                                                                                                                 
                                               CDS MIN     354      59                                                                                                                                                                 
                                               ORF LNG     354       7                                                                                                                                                                 
  5   1   2       add Te2N                            IMAGE:7768525.5p NAAAGGAGGTGTGTTTAAATGGCAGTCTTTTTATCCAATAGCCATTTATCTCGGTGAGGTGGCGGCGGGGCCTGCAAAATACGCTTTCAAGCAGATTGTGGAAGCTGTTACACTGCGTAGGTTTCCCCAGTCCTTCCCAGATTACGCAATTTACGTAGAAAGGCCTATTCCACATCGCTGGCTAAGGGGCCATGGCTACGTCATTAAAAATATCACAGGGCCCGTACAACAACATTCTGGTTTTTGTTCACTCAGGCCCCACCCACTCCACAATTAAAAGACCACACAGACATCAGCGCTAAAAAAGGACTTCAGTGTCGGCTCCTTTCGTGACTTTGGGTCTTTCCGCGGCTTCAGGACTTAGTCTGCTCGGCACTTCCACATTCGTCTGTTCGGGAATTAGATCGGGCGGCACCGATTCGGAGCTGTCAAGGGGGGCCCGGCTCTTTGAAAAGTGCAGCCCTGCCCGGTCCCCCCTTCAGGTCCGGCCACTTGTGTccccccccTGATGGCGGCCCTGATTCCAGCCAAGAAGTGTAAGATGAACTTTTCTGAGGAAGAAGTGGAGATCATCTTAGAGGAGATGGAGAAGCGGAAGCACATCCTCATTAACCACTTCAACGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACCTCCTGAAAACGCCAATGTCATCAGCATGTGCCACGCCATACCTCCCACATTTTGGAATAAAAGAGGGATAAAAGTTaaaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0063G11.5p                                                                                         GTGATTCTGACTTTAGCGTTGGAACGCCATTTATTATTTACAAGTTATTTCTAGAGTGTAAGCTGTCACAATCACATTCCTTTACTTGAAATTAGCGCAACGTTCTCGCAAGCTGCAAACCTATCAAATCGCCGTATTAATGATGGACAGCCCGGTAAACCAATCAGTGACCAGTCCTCTTTGAGTAGAACGAGGACCCGCTATAACAGAAGCTGAGGAGGTGTGCTTGAATGGCAGCCCTTTTGTCCAATAGCCCGTTGTCTCGTTGAGGGCGGGCTTCTGTCTGCGGCTATGCAGACTACGCATTCACGCAATAAAGAGGCAGATTCTGGAAACCGTTACGCTGCGTAGGTT
  5   1   2       bld Te2N 5g                         IMAGE:7768392.5p                                                                                                                                                         GTCACAATCACATTCCTTTACTTGAAATTAGCGCAACGTTCTCGCAAGCTGCAAACCTATCAAATCGCCGTATTAATGATGGACAGCCCGGTAAACCAATCAGTGACCAGTCCTCTTTGAGTAGAACGAGGACCCGCTATAACAGAAGCTGAGGAGGTGTGTTTGAATGGCAGCCCTTTTGTCCAATAGCCCGTTGTCTCGTTGAGGGCGGGCTTCTGTCTGCGGCTATGCAGACTACGCATTCACGCAATAAAGAGGCAGATTCTGGAAACCGTTACGCTGCGTAGGTTTCGTTTCTCCCGTCCTTCCCAGATTACGCAATTTACGTATAAAGGCCTATTCCACATCGCTGGCTAAGGGCCATGGCTACGCCAGCCAAGAAGCGTAAAATGAACTTTTCTGAGCAAGAAGTGGAGATCATCCTGGAAGAGATGGAGAAGCAGAAGCACATCCTCATTAACCACTTCAATGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACATCCTGAAGCGCGTCAATGCCAT
  5   1   2      seed Te2N 5g                         IMAGE:7768291.5p                                                                                                                                                          TCACAATCACATTCCTTTACTTGAAATTAGCGCAACGTTCTCGCAAGCTGCAAACCTATCAAATCGCCGTATTAATGATGGACAGCCCGGTAAACCAATCAGTGACCAGTCCTCTTTGAGTAGAACGAGGACCCGCTATAACAGAAGCTGAGGAGGTGTGTTTGAATGGCAGCCCTTTTGTCCAATAGCCCGTTGTCTCGTTGAGGGCGGGCTTCTGTCTGCGGCTATGCAGACTACGCATTCACGCAATAAAGAGGCAGATTCTGGAAACCGTTACGCTGCGTAGGTTTCGTTTCTCCCGTCCTTCCCAGATTACGCAATTTACGTATAAAGGCCTATTCCACATCGCTGGCTAAGGGCCATGGCTACGCCAGCCAAGAAGCGTAAAATGAACTTTTCTGAGCAAGAAGTGGAGATCATCCTGGAAGAGATGGAGAAGCAGAAGCACATCCTCATTAACCACTTCAATGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACATCCTGAAGCGCGTCAATGCCATCAGCACGTGCCACCGTGAGCTGGCCGAGGTCAAGAAGAAGTGGTCTGATCTGAAGACTGAGGTGCGAAGAAAGATGTCGCAGGCACGGTTGGCGGTGGAAGGTGAAGGCGATGTGGGCACGGCCCCGGTCATGCTCACCCCCATGCAGCAGCGCATATGTAACTTGCTGGGCGAGAGCGCAAA
  3   1   2       add Ga15                               XL507h03ex.3p                                                                                                                                                                                                                                                                              AATTAAAAGNCCCACACAGACATCAGNGTTAAAAAAGGACTTCAGTGTCGGCTCCTTTNGTGACTTTGGGTCTTTCCGCGGCTTCAGGACTTAGTCTGCTCGGCACTTCCACATTCGTCTGTTCGGGAATTAGATCGGGCGGCACCGATTCGGAGCTGTCAAGGGGGGCCCGGCTCTTTGAAAAGTGCAGCCCTGCCCGGTCCCCCCTTCAGGTCCGGCCACTTGTGTCCCCCCCCTGATGGCGGCCCTGATTCCAGCCAAGAAGTGTAAGATGAACTTTTCTGAGGAAGAAGTGGAGATCATCTTAGAGGAGATGGAGAACNCGGAAGCACATCCTCATTAACCACTTCAACGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACCTCCTGAAAAACGCCAATGTCATCAGCATGTGCCACCGCCATACCTCCCAACATTTTGGAAATAAAAAGAGGGATAAAAAAGTTGCCGCGTGTAGTGCAACAAATTTTTTGACCACACCCATTTTGTAACCACACCCCCTAATCAGGGGCGTAACTACAGAGGAAGCAGACCCTGCGGCTGCAGGGGGGCTCAAGAGGCATAGGGGGCCACATAAGGCTCTAATTAATTAGGAATTTTAATATATATTGTTAATACAGGGCAACCACTGGATATTTTGGGAGCCCTAAAATTATTTTGCTGTGGGGCCCAGTTACATCTAGTTACGCCACTGCCCCTTATTACCATGTTCACTTACAAA
  5   1   2       bld Em10 5x3                        IMAGE:8319515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCTCCCGTCCTTCCCAGATTACGCAATTTACGTATAAAGGCCTATTCCACATCGCTGGCTAAGGGCCATGGCTACGCCAGCCAAGAAGCGTAAAATGAACTTTTCTGAGCAAGAAGTGGAGATCATCCTGGAAGAGATGGAGAAGCAGAAGCACATCCTCATTAACCACTTCAATGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACATCCTGAAGCGCGTCAATGCCATCAGCACGTGCCACCGTGAGCTGGCCGAGGTCAAGAAGAAGTGGTCTGATCTGAAGACTGAGGTGCGAAGAAAGATGTCGCAGGCACGGTTGGCGGTGGAAGGTGAAGGCGATGTGGGCACGGCCCCGGTCATGCTCACCCCCATGCAGCAGCGCATATGTAACTTGCTGGGCGAGAGCGCAATACTAACCCTTCCGTCCGACATACCTGGCCAAGTGGGGATCAACTCGCCTGGCAGCATGGCCTTGTCCCAAATTGCACCAGAGACAACGTTTCACGCCCTAGAAGAGAATGTGGTGGAGTACTGCACCACAGAGACAGCTACAACGGTAACCACAGATGCCCCCGTAGGAATCATATCTCCTTCTCATGAAGTCTCTGTAAAACCCAAGAGCTGAAGAATCGAATTGCTCTGAACTCTGCCCGGCTCCTGCAGGAACAGCGCGTGACCAACCCTCATGTAAAGGAGATAGCTCAGCACCTCGAAACACAGAACGACATCCTGCACATGATTC
  5   1   2       bld Egg1 5g                            PBX0050E04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACGAGGGTATAAAGGCCTTCCACATCGCTGGCTAAGGGCCATGGCTACGCCAGCCAAGAAGCGTAAAATGAACTTTTCTGAGCAAGAAGCGGAGATCATACTGGAAGAGATGGAGAAGCAGAAGCACATCCTCATTAACCACTTCAATGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACATCCTGAAGCGCGTCAATGCCATCAGCACGT
  5   1   2       bld FaBN 5x3                        IMAGE:8078023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCCATGGCTACGCCAGCCAAGAAGCCTTAATGAACTTTTCTGAGCAAGAAGTGGAGATCATCCTGCAATAGATGGAGAAGCAGAAGCACATCCTCATTAACCACTTCAATGCTGGGGTGCCTCTGGTGACCAAAAGCAACGCCTGGCACGACATCCTGAAGCGCGTCAATGCCATCAGCACGTGCCACCGTGAGCTGGCCGAGGTCAAGAAGAAGTGGTCTGATCTGAAGACTGAGGTGCGAAGAAAGATGTCGCAGGCACGGTTGGCGGTGGAAGGTGAAGGCGATGTGGGCACGGCCCCGGTCATGCTCACCCCCATGCAGCAGCGCATATGTAACTTGCTGGGCGAGAGCGCAATACTAACCCTTCCGTCCGACATACCTGGCCAAGTGGGGATCAACTCGCCTGGCAGCATGGCCTTGTCCCAAATTGCACCAGAGACAACGTTTCACGCCCTAGAAGAGAATGTGGTGGAGTACTGCACCACAGAGACAGCTACAACGGTAACCACAGATGCCCCCGTAGGAATCATATCTCCTTCTCATGAAGTCTCTGTAAAACCCCAAGAGCTGAAGAATCGAATTGCTCTGAACTCTGCCCGGCTCCTGCAGGAAAGCGCGTGACCACCTCCATGAAAGGAAAAGCTCACACCTCGAAAACATAAAACACCCGCAATGATTCCCGTTCCCAGAAGTGTACCAATGTTAAGAACACAACCCAGCCATGAGGATCTAGCACATCATGCTCATCATTCTAACAATGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)