Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-xlk158a05ex.3                        95 PI      90         76      861                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012782851 Xl3.1-IMAGE:5515392.5 - 3 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5515392.5 CAGAGAGAGCTAAGCGCTTGTCATGGGGGTGGATGAACGCTGTGAGAGGTGGAGGTTTATTTGGGATATTTAGTTTGGCGGTAGTGGGATTCCATCGGTAAGGAGATTCCGGTAGGAAGTACGGAGAAGCAGAGCCAGGCGAAGGGGAGGCGGTCACAGACAAGGATAATCATGGGCCAGACAGGCAAGAAATCTGAGAAGGGAGCGGTGTGTTGGCGCAAGCGGGTGAAATCGGAGTACATGCGCTTAAGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGTCAAAAGATAATGGAACGAACTGAGATTTTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCTGTGCACATAATGACTACAGTCAGTTCTTTAAGAGGGACTAGAGAGTGCTTTGTGACTAGTGATTTAGATTTCCCAAAACAAGTTATACCTTTGAAAACACTCACTGCTGTAGCCTCTATGCCTATTATGTATTCCTGGTCTCCTCTTCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGTACCAATATGGGTACTTTATTGAAGAACTCATTAAGAATTATGATGGAAAAAGTTCATGGAGACAGAGAATGCGGTTTCATTAATGGATATTTTAGTTGTGGAGTTAGTCAATGCATTGGCACAATACAGCGATTATGAAGACGATGAAAGATGGGAGAGGGATAATCAAGATGATGAGAGGGATGACATAACAAAAGATCAGGATGAATACCATGGAGGGAAAAGGGAAACTCTGCCCTCTCAAGAAATTTCCCCTCTTGGATAAAATTTTTTTGAAAGCAATATTC
                                                  Xl3.1-CHK-1012711998       GAGCTAAGCGCTTGTCATGGGGGTGGATGAACGCTGTGAGAGGTGGAGGTTTATTTGGGATATTTAGTTTGGCGGTAGTGGGATTCCATCGGTAAGGAGATTCCGGTAGGAAGTACGGAGAAGCAGAGCCAGGCGAAGGGGAGGCGGTCACAGACAAGGATAATCATGGGCCAGACAGGCAAGAAATCTGAGAAGGGAGCGGTGTGTTGGCGCAAGCGGGTGAAATCGGAGTACATGCGCTTAAGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGTCAAAAGATAATGGAACGAACTGAGATTTTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCTGTGCACATAATGACTACAGTCAGTTCTTTAAGAGGGACTAGAGAGTGCTTTGTGACTAGTGATTTAGATTTCCCAAAACAAGTTATACCTTTGAAAACACTCACTGCTGTAGCCTCTATGCCTATTATGTATTCCTGGTCTCCTCTTCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGTACCAAxxxxGGxACxTTATTGAAGAACTCATTAAGAATTATGATGGAxAAxxTTCATGGAGACAGAGAATGCGGTTTCATTAATGxxxATTTTAGxxxTxGAGTTAGTCAATGCATTGGCACAATACAGCGATTATGAAGACGATGAAAGATGGGAGAGGGATAATCAAGATGATGAGAGGGATGACATAACAAAAGATCAGGATGAATACCATGGAGGGAAAAGGGAAACTCTGCCCTCTCAAGAAATTTCCCCTCTTGGATAAAATTTTTTTGAAAGCA
                                                      consensus depths      1     1     1     1     1     2     1     3     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2
                                               BLH ATG     171     492 
                                               BLH MIN     132      85 
                                               BLH MPR      99      85 
                                               BLH OVR     171     755 
                                               ORF LNG     171      17 
                                                                                                                                                                                                                                                                 PROTEIN -== Ag ==== 4e-032     XP_307419.2 ENSANGP00000012923 [Anopheles gambiae str. PEST] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 4e-031     NP_524021.2 Enhancer of zeste CG6502-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED - Sp ---- 3e-035     XP_001195253.1 PREDICTED: similar to ENX-1 [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PREDICTED = Dr ==== 2e-075     NP_001070747.1 hypothetical protein LOC768133 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 4e-083     NP_031997.1 enhancer of zeste homolog 2 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 2e-083     NP_004447.2 enhancer of zeste 2 isoform a; enhancer of zeste 2 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PREDICTED = Bt ==== 8e-084     XP_870752.2 PREDICTED: similar to enhancer of zeste homolog 2 isoform 2 [Bos taurus] ================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PREDICTED = Cf ==== 8e-084     XP_532733.2 PREDICTED: similar to enhancer of zeste 2 isoform a isoform 1 [Canis familiaris] ========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PREDICTED - Gg ---- 2e-087     XP_418879.2 PREDICTED: similar to Enhancer of zeste homolog 2 (Drosophila) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 1e-094     CAJ83863.1 enhancer of zeste homolog 2 (Drosophila) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 1e-098     AAH97526.1 Unknown (protein for MGC:114648) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:5515392.5                                  TGA------TGA------------------------------------TAG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------ATG------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------ATG------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------ATG---------TAA---------TAG---------TAG---ATG---------------------ATG------ATG------------------------ATGATG------ATG---TAA------------ATG------ATG
                                                                   ORF                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2      seed Emb4 5g                         IMAGE:5515392.5p CAGAGAGAGCTAAGCGCTTGTCATGGGGGTGGATGAACGCTGTGAGAGGTGGAGGTTTATTTGGGATATTTAGTTTGGCGGTAGTGGGATTCCATCGGTAAGGAGATTCCGGTAGGAAGTACGGAGAAGCAGAGCCAGGCGAAGGGGAGGCGGTCACAGACAAGGATAATCATGGGCCAGACAGGCAAGAAATCTGAGAAGGGAGCGGTGTGTTGGCGCAAGCGGGTGAAATCGGAGTACATGCGCTTAAGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGTCAAAAGATAATGGAACGAACTGAGATTTTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCTGTGCACATAATGACTACAGTCAGTTCTTTAAGAGGGACTAGAGAGTGCTTTGTGACTAGTGATTTAGATTTCCCAAAACAAGTTATACCTTTGAAAACACTCACTGCTGTAGCCTCTATGCCTATTATGTATTCCTGGTCTCCTCTTCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTAAAAACTATGATGGAAAAGTTCATGGAGACAGAGAATGCGGTTTCATTAATGATGAGATATTTGTGGAGTTTAGTCATGCATTGGCANCATACAGCGATTATGAAGACGATGAAGATGGAGAGGATNNATCAGATGATGAGAGGGATGACANTACAAAAGATCAGGATGANTACATGGANGA
  5   1   2       chi Brn3                            IMAGE:8540433.5p                      CCCATGTTATATGGGGTGCTCGATTCGAATTCGTCCCATTTGGGATATTTAGTTTGGCGGTAGTGGGATTCCATCGGTAAGGAGATTCCGGTAGGAAGTACGGAGAAGCAGAGCCAGGCGAAGGGGAGGCGGTCACAGACAAGGATAATCATGGGCCAGACAGGCAAGAAATCTGAGAAGGGAGCGGTGTGTTGGCGCAAGCGGGTGAAATCGGAGTACATGCGCTTAAGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGTCAAAAGATAATGGAACGAACTGAGATTTTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCTGTGCACATAATGACTACTGTCAGTTCTTTAAGAGGGACTAGAGAGTGCTTTGTGACTAGTGATTTAGATTTCCCAAAACAAGTTATACCTTTGAAAACACTCACTGCTGTATCCTCTATGCCTATTATGTATTCCTGGTCTCCTCTTCAGCATAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGATGAGGTTTTGTACCAATATGGGTACTTTATTGAAGAACTCATTAAGAATTATGATGGACAAGTTTTTGAAACAGATAATGTGTCTCTCTTATGATGGATATTTTAGGATTTGTAATGCTTCGTTCTGTTTGCATTGTATTTTACAATATGTAATGAATTCCTATGAGAATGAAACTCTCTATATCTTATTAATCTTAGTTTCGACCTCCTCTAGACTTCTTTTAAATTTTACATATCCTGTTCACTCGTTATTGAGGTNATTNCTTTTTATTTTTCGGTTCTTAATTATTTTGTATAATTC
  5   1   1       add Emb1 5g                         IMAGE:5156161.5p                                     CGCTGTGAGAGGTGGAGGTTTATTNTGGGATATTTAGTTTGGCGGTAGTGGGATTCCATCGGTAAGGAGATTCCGGTAGGAAGTACGGAGAAGCAGAGCCAGGCGAAGGGGAGGCGGTCACAGACAAGGATAATCATGGGCCAGACAGGCAAGAAATCTGAGAAGGGAGCGGTGTGTTGGCGCAAGCGGGTGAAATCGGAGTACATGCGCTTAAGGCAACTCAAGAGATTTAGACGAGCAGATGAAGTAAAGAGCATGTTTAACACAAATCGTCAAAAGATAATGGAACGAACTGAGATTTTAAATCAAGAGTGGAAACAGCGCAGAATCCAGCCTGTGCACATAATGACTACAGTCAGTTCTTTAAGAGGGACTAGAGAGTGCTTTGTGACTAGTGATTTAGATTTCCCAAAACAAGTTATACCTTTGAAAACACTCACTGCTGTAGCCTCTATGCCTATTATGTATTCCTGGTCTCCTCTTCAGCAGAATTTCATGGTGGAAGATGAAACTGTTCTGCATAATATTCCATATATGGGTGGATGAGGTTTTGGACCAAGATGGGACATTTATTGAAGAACTCATTANAAACTATGATGGAAAAGTTCATGGAGACAGAGAATGCGGTTTCATTAATGATGAGATANTTTGTGGAGTTAGTCAATGCATTGGCACAATACAGCGATTATGAAGACGATGAAAGATGGGAGAGGGATAATCAAGATGATGAGAGGGATGACATAACAAAAGATCAGGATGAATACCATGGAGGGAAAAGGGAAACTCTGCCCTCTCAAGAAATTTCCCCTCTTGGATAAAATTTTTTTGAAAGCAATATTCCTTCAGTGGTTTTCCAGGACCAAAGGGTTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)