Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Feb 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:3581609.5                       6 END     3          50       50                XFD-11 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:5514684.5                       3 PI      89          1      812                winged helix transcription factor XFD-11 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012782881 Xl3.1-XL093l08.3 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-XL093l08.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCCTGCCAACACCCCAGCAGCCACCACGGTGGAAGAGACCTTACCTGACTATTCCATCACTACCACCACCTCTGCCTTGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAACTGGGGATTTGGGCCACTTGGCCGGGGCTTCCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAAAGACTGGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCATTTGTCTATGACTGCAGCAAATTCTGACCAAAATGCTGAAAACAAATAATTTTTTAATTTTTTTCTAATAGGGATTTTTTTTAAAGAAAGGAAAAAACACCCTCCTTTTCCAAAAATATCACATTTGTTAGTTTTGTACAGACAGCAAAATTGTGTATTGGTTTGTTAAAAAGGGACCGTGTTAAACTCGGAAAATAACAAGTAAATTCCATCTGCCTGTGATACATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGATAAAAATAAATGTACCTGGATTGTGTGGACCAAAACAGCCAGTGGCGACCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTAAAATATCCCGAAGGCTCTA
                                                  Xl3.1-CHK-1012701450                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAACACCCCAGCAGCCACCACGGTGGAAGAGACCTTACCTGACTATTCCATCACTACCACCACCTCTGCCTTGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAACTGGGGATTTGGGCCACTTGGCCGGGGCTTCCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAAAGACTGGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCATTTGTCTATGACTGCAGCAAATTCTGACCAAAATGCTGAAAACAAATAATTTTTTAATTTTTTTCTAATAGGGATTTTTTTTAAAGAAAGGAAAAAACACCCTCCTTTTCCAAAAATATCACATTTGTTAGTTTTGTACAGACAGCAAAATTGTGTATTGGTTTGTTAAAAAGGGACCGTGTTAAACTCGGAAAATAACAAGTAAATTCCATCTGCCTGTGATACATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGATAAAAATAAATGTACCTGGATTGTGTGGACCAAAACAGCCAGTGGCGACCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTAAAATATCCCGAAGGCTCTAAGCACC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     4     4     5     4     5     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     2
                                                                       ...PROTEIN --- Gg ---- 4e-011     NP_990469.1 winged helix transcriptional factor MFH-1 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 1e-016     XP_872296.3 PREDICTED: similar to forkhead box C2 [Bos taurus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-017     XP_546791.2 PREDICTED: similar to Forkhead box protein C2 (Forkhead-related protein FKHL14) (Mesenchyme fork head protein 1) (MFH-1 protein) (Transcription factor FKH-14) isoform 1 [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 5e-039     NP_001444.2 forkhead box C1 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 7e-041     NP_032618.2 forkhead box C1; mesoderm/mesenchyme forkhead 1; congenital hydrocephalus [Musmusculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 9e-050     XP_001918817.1 PREDICTED: hypothetical protein [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-061     NP_001007864.1 foxc1-prov protein [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 2e-064     NP_001089846.1 hypothetical protein LOC734912 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-XL093l08.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------------------------------------ATG------------------------------------------------------------------TGA---------TGA---------------TAA------------------------TAA---------------------------------------------------------------------------------------------------------------TAA---------------------TGA---------TAA---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2      skin Brn1      in                    IMAGE:6950169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGAGGCTGCAGAGTCTcaccacccgcaccagcagcagcaccaccaccacagccagGGTTTCAGCGTGGATAACATCATGACCTCCCTCAGGGGCTCCCCCCAGGGCTCAGGAGAACTCCCTTCTCCCCTCATCTCTTCTTCCAGGACAGGTATCGCCCCCTCCTTGTCCCTCACCTATTCCCCAAGTCAGGGCTCCATCTACAGTCCCCCCTGCAGTCAGGGCAGCAGCAGTGGCGGTGGGGCAGGGACCTATCACTGTAATATGCAGGCCATGAGCTTGTATTCTGGGGACAGGTCGGGCCACTTGACTCCTGCCAACACCCCAGCAGCCACCACGGTGGAAGAGACCTTACCTGACTATTCCATCACTACCACCACCTCTGCCTTGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAACTGGGGATTTGGGCCACTTGGCCGGGGCTTCCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAAAGACTGGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCATTTGTCTATGACTGCAGCAAATTCTGACCAAAATGCTGAAAACAAATAAttttttaatttttttctaatagggatttttttttAAAGAAAGGAAAAAACACCCTTCCTTTTCCAAAAATATCACATTTTGTTAGTTTTTGTACAGACAGCCAAAATTGTGGAATTGGTTTTGTTTAAAAAAGGGACCGGTGTTTAAACTTCGGAAAATAACAAGGTAAAATTTCCATCTGCCTGGTTGAAACCATCTCCGTAAAGGTA
  3   1   2       bld Brn1      in                    IMAGE:6950169.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGGGACAGGTTCGGGCCCACTTGACTCCTGCCAACACCCCAGCAGCCACCACGGTGGAAGAGACCTTACCTGAATATTCCATCACTACCACCACCTTTGCCTTGAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAACTGGGGATTTGGGCCACTTGGCCGGGGCTTCCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAAAGACTGGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCATTTGTCTATGACTGCAGCAAATTCTGACCAAAATGCTGAAAACAAATAATTTTTTAATTTTTTTCTAATAGGGATTTTTTTTAAAGAAAGGAAAAAACACCCTCCTTTTCCAAAAATATCACATTTGTTAGTTTTGTACAGACAGCAAAATTGTGTATTGGTTTGTTAAAAAGGGACCGTGTTAAACTCGGAAAATAACAAGTAAATTCCATCTGCCTGTGATACATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGATAAAAATAAATGTACCTGGATTGTGTGGACCAAAACAGCCAGTGGCGACCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTTTTTCTGTTTGAAAATTCCCGAAGCTCTAAGCAC
  3   1   2       bld Tbd5      out                   IMAGE:3581609.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGACAGGTCGGGCCACTTTACTCCTGCCAACACCCCAGCAGCCACCACGGTGGAAGAGACCTTACCTGACTATTCCATCACTACCACCACCTCTGCCTTTAGCCATGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAACTGGGGATTTGGGCCACTTGGCCGGGGCTTCCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAAAAATGTTTGAGTCGCAAAGACTGGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCATTTGTCTATGACTGCAGCAAAT
  3   1   2       add Ga18      out                     xlk102k02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCACNAGGCCGATNGCCCTCNNNGTATCTNAATCAAACTGGGGATTTNNNNNCTTNNNNGGGCTNNNTANCCGNNNNGCAGNAGAACTTCCACNCGGTGCGAGAGATGTNTGAGTCGCAAAGACTGGGATTGAACANNTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCNCCAGCCAGTCCTTGTACCGCACCTCGGGGGCATTTGTCTATGNCTGCAGCAAATTCTGACCAAAATGCTGAAAACAAATAATTTTTTAATTTTTTTCTAATAGGGATTTTTTTTAAAGAAAGGAAAAAACACCCTCCTTTTCCAAAAATATCACATTTGTTAGTTTTGTACAGACAGCAAAATTGTGTATTGGTTTGTTAAAAAGGGACCGTGTTAAACTCGGAAAATAACAAGTAAATTCCATCTGCCTGTGATACATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGATAAAAATAAATGTACCTGGATTGTGTGGACCAAAANNNNAGTGGCGACCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTAAAATNTCCCGAANCNCTAA
  3   1   2      seed Tbd7                                 XL093l08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCCGATTGCCCTCTTGGTATCTCAATCAAACTGGGGATTTGGGCCACTTGGCCGGGGCTTCCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAAAGACTGGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCATTTGTCTATGACTGCAGCAAATTCTGACCAAAATGCTGAAAACAAATAATTTTTTAATTTTTTTCTAATAGGGATTTTTTTTAAAGAAAGGAAAAAACACCCTCCTTTTCCAAAAATATCACATTTGTTAGTTTTGTACAGACAGCAAAATTGTGTATTGGTTTGTTAAAAAGGGACCGTGTTAAACTCGGAAAATAACAAGTAAATTCCATCTGCCTGTGATACATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGATAAAAATAAATGTACCTGGATTGTGTGGACCAAAACAGCCAGTGGCGACCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTAAAATATCCCGAAGGCTCTAAGCACCGTT
  3   1   2       bld Tbd7 5g3  out                        XL084h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAATCAAACTGGGGATTTGGGCCACTTGGCCGGGGCTTCCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTTGAGTCGCAAAGACTGGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCATTTGTCTATGACTGCAGCAAATTCTGACCAAAATGCTGAAAACAAATAATTTTTTAATTTTTTTCTAATAGGGATTTTTTTTAAAGAAAGGAAAAAACACCCTCCTTTTCCAAAAATATCACATTTGTTAGTTTTGTACAGACAGCAAAATTGTGTATTGGTTTGTTAAAAAGGGACCGTGTTAAACTCGGAAAATAACAAGTAAATTCCATCTGCCTGTGATACATCTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGATAAAAATAAATGTACCTGGATTGTGTGGACCAAAACAGCCAGTGGCGACCAGAACACTTATGTGTCACAACATTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTAAAATATCCCGAAGGCTCTAAGCACCGTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)