Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7765254.3                      28 PI      90        403      863                Death-associated protein-like 1-B

 This cluster: approximate FL confidence score = 75%

 1012783049 Xl3.1-IMAGE:4032423.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4032423.5 CGCCAGAGTCATTCTGTTGTATACTTAATAAAGCACCCCAGAAAAAGGAGATCCTCATTGCAAAGCTGACACACACTATTTTAATTTCTAATGTTCATATATGGGAGAACAGTACNTAAGATCTTGTAATAAAAAGCTGGTGTAGGTATGGGGTCTTTCCTCCGGCCTTAGAACTGAAAAGACTTTAATGTATTACAGCAAAATTTATAAATTTGAAAGAAAATTGTAGTGAGCTCCTATATAAAAGCCAGTAGTCTTATCAGTCAAAGATTGTTTTGTCCTTCATATTCGCCAAGCTAGTGTCCTGTTCAAGGTGTGTGGGGCACTAAAAGCTTATGGGCAATGTTCCACATATGCCATAAGTGTTCGTGCTCTTCCTCATCTCCAATCTTTACCCAGACTGAGACTGATCATGGCTAAAGAGCAGAAAATGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCACCTTCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAACAAGGTAACGAAGAAAACAGTGCGCCCGAGAAAAACGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACAAAGATGCAAGCAATGAATATTTTGGCTGGAGAGCTAGAGAAGCTCAGCCACGACTTTCCTGGAGAAGCCGCACAGATTGCGCATCAAAAACCGCGGCCTACTGTTGAGAAGACCATTCTGCCGAAAAGGCTCTACATTATTCAGCAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAAGAAGAAAATAACTGTCACTTTTCCCTAAATCGGTTTTGTACCATTTTTGATAAAGCACTTTGTTGCATTGAAAG
                                                  Xl3.1-CHK-1012707645       AGTCATTCTGTTGTATACTTAATAAAGCACCCCAGAAAAAGGAGATCCTCATTGCAAAGCTGACACACACTATTTTAATTTCTAATGTTCATATATGGGAGAACAGTACNTAAGATCTTGTAATAAAAAGCTGGTGTAGGTATGGGGTCTTTCCTCCGGCCTTAGAACTGAAAAGACTTTAATGTATTACAGCAAAATTTATAAATTTGAAAGAAAATTGTAGTGAGCTCCTATATAAAAGCCAGTAGTCTTATCAGTCAAAGATTGTTTTGTCCTTCATATTCGCCAAGCTAGTGTCCTGTTCAAGGTGTGTGGGGCACTAAAAGCTTATGGGCAATGTTCCACATATGCCATAAGTGTTCGTGCTCTTCCTCATCTCCAATCTTTACCCAxxCTGAGACTGATCATGGCTAAAGAGCAGAAAATGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCACCTTCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAACAAGGTAACGAAGAAAACAGTGCGCCCGAGAAAAACGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACAAAGATGCAAGCAATGAATATTTTGGCTGGAGAGCTAGAGAAGCTCAGCCACGACTTTCCTGGAGAAGCCGCACAGATTGCGCATCAAAAACCGCGGCCTACTGTTGAGAAGACCATTCTGCCGAAAAGGCTCTACATTATTCAGCAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAAGAAGAAAATAACTGTCACTTTTCCCTAAATCGGTTTTGTACCATTTTTGATAAAGCACTTTGxxxxxT
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     4     2     4     2     3     1     2
                                               BLH ATG     412      84 
                                               BLH MIN     412      29 
                                               BLH MPR     412      29 
                                               BLH OVR     412     130 
                                               ORF LNG     412       1 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 4e-009     XP_001179737.1 PREDICTED: similar to death-associated protein [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Gg ---- 2e-010     NP_001026174.1 death-associated protein [Gallus gallus] ================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 2e-017     NP_571648.1 death associated protein 1b [Danio rerio] ========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Mm ==== 4e-021     NP_083999.1 hypothetical protein LOC76747 [Mus musculus] =====================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Hs ==== 9e-022     NP_001017920.1 hypothetical protein LOC92196 [Homo sapiens] ========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Cf ==== 7e-023     XP_849683.1 PREDICTED: similar to death associated protein 1b [Canis familiaris] ===================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Bt ==== 2e-024     NP_001020517.1 early epithelial differentiation-associated protein [Bos taurus] ====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 9e-056     Q28CI6.1 Death-associated protein-like 1 [Xenopus tropicalis]  =====================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 4e-059     A3KMT2.1 Death-associated protein-like 1-A [Xenopus laevis]  =======================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4032423.5                          TAATAA---------------------------------------------------------TAA---------ATG---------------------------------------TAG------------------------------------------ATG------------------------------------TAGTGA---------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                            ]
  3   1   2       chi Thy                             IMAGE:8550824.3p CGCCAGAGTCATTCTGTTGTATACTTAATAAAGCACCCCAGAAAAAGGAGATCCTCATTGCAAAGCTGACACACACTATTTTAATTTCTAATGTTCATATATGGGAGAACAGTACNTAAGATCTTGTAATAAAAAGCTGGTGTAGGTATGGGGTCTTTCCTCCGGCCTTAGAACTGAAAAGACTTTAATGTATTACAGCAAAATTTATAAATTTGAAAGAAAATTGTAGTGAGCTCCTATATAAAAGCCAGTAGTCTTATCAGTCAAAGATTGTTTTGTCCTTCATATTCGCCAAGCTAGTGTCCTGTTCAAGGTGTGTGGGGCACTAAAAGCTTATGGGCAATGTTCCACATATGCCATAAGTGTTCGTGCTCTTCCTCATCTCCAATCTTTACCCATTCTGATGACTTAAAAATACTGCTTATTGTGCTGTCAGACAGGGATCCTTCAGGAACAGCTGTATAGCTACTGTAAATGTGGAACCAATTATGCCAGACAGCCCCCCAGCTTTATGAACCAATGAGAATTTACACTTGGATTTGTATTCTTATTGACTTTTCTCCCTTCTCTTAGCTCTGTTCTTAACATGACAAAGATGCAAGCAATGAATATTTTGGCTGGAGAGCTAGAGAAGCTCAGCCACGACTTTCCTGGAGAAGCCGCACAGATTGCGCATCAAAAACCACGGCCTACTGTTGAGAAGACCATTCTGCCGAAAAGGCTCTACATTATTCAGCAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAAGAAGAAAATAACTGTCACTTTTCCCTGAATAATCGGTTTTGTACCATTTGAAAGCATCTAA
  5   1   2       bld Kid  5x3               IMAGE:4032423-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                         AGCACAGACTGAGACTGATCATGGCTAAAGAGCAGAAAATGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCACCTTCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAACAAGGTAACGAAGAAAACAGTGCGCCCGAGAAAAACGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACAAAGATGCAAGCAATGAATATTTTGGCTGGAGAGCTAGAGAAGCTCAGCCACGACTTTCCTGGAGAAGCCGCACAGATTGCGCATCAAAAACCGCGGCCTACTGTTGAGAAGACCATTCTGCCGAAAAGGCTCTACATTATTCAGCAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAAGAAGAAAATAACTGTCACTTTTCCCTAAATCGGTTTTGTACCATTTTTGATAAAGCACTTTGCATTGAAAGCaaaaaaaaaaaaaaa
  5   1   2       bld Kid  5x3                        IMAGE:4032423.5p                                                                                                                                                                                                                                                                                                                                                                                                          GCACAGACTGAGACTGATCATGGCTAAAGAGCAGAAAATGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCACCTTCCTGCAGTGAAAGCTGGAGGAATGAGGGTTTCCAAAAAACAAGGTAACGAAGAAAACAGTGCGCCCGAGAAAAACGCAAAGAAAACCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACAAAGATGCAAGCAATGAATATTTTGGCTGGAGAGCTAGAGAAGCTCAGCCACGACTTTCCTGGAGAAGCCGCACAGATTGCGCATCAAAAACCGCGGCCTACTGTTGAGAAGACCATTCTGCCGAAAAGGCTCTACATTATTCAGCAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCCTGTACATAAGTAAAAGAAGAAAATAACTGTCACTTTTCCCTAAATCGGTTTTGTACCATTTTTGATAAAGCACTTTGCATTGTAAGCAAAACN
  5   1   2      seed Egg1 5x3                           PBX0119F12.5p                                                                                                                                                                                                                                                                                                                                                                                                              GGCACGAGGCTGATCATGGCTAAAGAGCAGAAAATGCAGAGTTCTCCCCAAGCCCTAAAGGCTGGTCACCTTCCTGCAGTGAAAGCTGGAGGAATGAGGGTTtccaaaaaacaaggtaacgaagaaaacagtgcgcccgagaaaaacgcaaagaaaacCTTGCAGGAGAAACCAAGCTCTGTTCTTAACATGACAAAGATGCAAGCAATGAATATTTTGGCTGGAGAGCTAGAGAAGCTCAGCCACGACTTTCCTGGAGAAGCCGCACAGATTGCGCATCAAAAACCGCGGCCTACTGTTGAGAAGACCATTCTGCCAAAAAGGCTCTACATTATTCAGCAGCCTCGCAGATGTTAGATTGCATGTACTCTGGTGTCATGTACATAAGTAAAAGACGAAAATAACTGTCACTTTTCCCTGAATAATCGGTTTTGTACCATTTTTGATAAAGCACTTTGCATTGAAAGCCNANaaaaaaaaaaaaaaaaaaaaaaaaaaGATTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)