Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl244e24.3                           16 END     7          63       43                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl281h09.3                           11 PI      83       1487     1837                (no blast hit)
     3   0.0    0Xl3.1-XL105d03.5                            2 PI      90          1     1109                hypothetical protein LOC399019 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012783061 Xl3.1-XL452g09ex.5 - 11 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL452g09ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAAGCATTGGCTCAAGACCCTGCAGGAGAGCAGTGTCTGCCCATGATCTCCCAAGATACATTTCCCAGTCACCTCAGCCTGGACATAGGGATGACCATCTCACTAGATTGCAGGGCAACAGCAGAGCCTGAACCAGAAATATACTGGGTAACTCCTTTGGGGCATAAAGTGACTTTGGAAACTCTTTCTGACAAGTACCACTTAAGTGGAGAGGGCAGTTTGCAGATTTTTAATGTGCAGGTGGAGGATTCTGGACGTTACACGTGTGTGGCGCAGAATTCAGAAGGAGCAGATACAAAGGTAGCCACCCTGAGAGTAAATGGAACCTTGTTAGATGGCACACAAGCTCTTAGACTCTATGTTCAACAAGCAGAATCCAGTTCAGTCTTGGTATCATGGAAAGTTAGTTCAAGTGTTTTGGCTTCTAACCTTAAGTGGTCTTCAGCCACTATGAAGATTGATAACCCCCATATCACTTATACAGCACGTGTGCCAGCGGATGTCCACGAGTATAATCTCACCCATCTCCAGCCAGCCACTGAATATGAAGTGTGCCTGACGGTGTCGGGGCTACACCAACAAGCTCAGCGTGCCTGCATCAATGTCACCACTAAAGGCACGTCCTACTCGTTGACTGTTACTGATCAGGAGACCAGTGCTGCCCTGGCTGCCGTCATGGGTTCCCTATTCGCCCTAATAAGTTTTGCCTCTGTTTCTGTTTATGCCGCCAAGAGGTTCCAGAGAAAGAATTATCGCCACTCGTTGAAGAAGTATATGCAAAAGACCTCATCCATTCCACTCAACGAGCTTTATCCTCCTCTCATAAGCCTGTGGGAGGGAGACAGCGAAAAAGAAAAAGAGGGGACAGCAGAATCGAAAGCTTCCCAGGTGGACACATCCCGGAGCTATTACATGTGGTAACTCACACATTAGAGACCTAACAACAGAGCACAAACACTGATGGACACCTCTCAGAAAAACTTGCTTTCCTTTCCTTTGGTTTTGTTTTGTTTTCTAACCTTGTGTCACTTTTGCTCTTTATCCCAGTCGCATTCTCTTTGACTGTTTCCCATTTATTTGCTTTGACGTTCTTTCTTTTTATATATACACTGTCTGGGCAAAGTAGAACCGATCATTGAAATAACAAGTCATTGAGGAGTATTTTGATCATATTAGGACAAGGAGCAATAGGTCAAGACTTTTTTGTAGGATACAGAACCTTCTGTGGTGGCCTTATCTAGCATTACATGTAGTTCTAAGTTAGACTGTCTATCCTGGAGACCTTATATGTAGAGTGTCATTTTCATTCTGATGTGGATTAACCACAAACAGGCTTTATGGCCAATTAAAAGAATTCTCCTCCAAAGAGGGGCCCAATGAACTAGAATATCGGGAAGCTGTAGGAGATACAGTCCATTCACACAAGCTGTCTCCTATCCATCATGCTTTTTTTATATTCTCCTAAATGTGCTTATTGAAATCTCCCATCTGGAAAGGTCACGGTTCCATTTTAGAAGGCAGGGTATTAATAATTGACGGGCAAGTTCTGCCTCTCGTTGTGTCAGAGCAGCTTGCATTTAAGTACCGCTCGCTTGAATAGGGCCACTACGGACAATTCTGTGATTCAACAGTATGGATTATGCATGCCGCAGCCTTTCCAGCAGCGATATAAACTTTCTGAAGGTCAGTAGTGTCAGACATATTGGCTATGAATATTTGGCTGTGAGCGTGTTTGCCGCATACAGATTACAGCGTGTATATGTATTATGGGACATACTGTATTAATGCAAGGGTTTGACCAGACAGTGTATATACCAGAGTTATTATTATTATTACTTTTTTTTTT
                                                  Xl3.1-CHK-1012695274                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATTGGCTCAAGACCCTGCAGGAGAGCAGTGTCTGCCCATGATCTCCCAAGATACATTTCCCAGTCACCTCAGCCTGGACATAGGGATGACCATCTCACTAGATTGCAGGGCAACAGCAGAGCCTGAACCAGAAATATACTGGGTAACTCCTTTGGGGCATAAAGTGACTTTGGAAACTCTTTCTGACAAGTACCACTTAAGTGGAGAGGGCAGTTTGCAGATTTTTAATGTGCAGGTGGAGGATTCTGGACGTTACACGTGTGTGGCGCAGAATTCAGAAGGAGCAGATACAAAGGTAGCCACCCTGAGAGTAAATGGAACCTTGTTAGATGGCACACAAGCTCTTAGACTCTATGTTCAACAAGCAGAATCCAGTTCAGTCTTGGTATCATGGAAAGTTAGTTCAAGTGTTTTGGCTTCTAACCTTAAGTGGTCTTCAGCCACTATGAAGATTGATAACCCCCATATCACTTATACAGCACGTGTGCCAGCGGATGTCCACGAGTATAATCTCACCCATCTCCAGCCAGCCACTGAATATGAAGTGTGCCTGACGGTGTCGGGGCTACACCAACAAGCTCAGCGTGCCTGCATCAATGTCACCACTAAAGGCACGTCCTACTCGTTGACTGTTACTGATCAGGAGACCAGTGCTGCCCTGGCTGCCGTCATGGGTTCCCTATTCGCCCTAATAAGTTTTGCCTCTGTTTCTGTTTATGCCGCCAAGAGGTTCCAGAGAAAGAATTATCGCCACTCGTTGAAGAAGTATATGCAAAAGACCTCATCCATTCCACTCAACGAGCTTTATCCTCCTCTCATAAGCCTGTGGGAGGGAGACAGCGAAAAAGAAAAAGAGGGGACAGCAGAATCGAAAGCTTCCCAGGTGGACACATCCCGGAGCTATTACATGTGGTAACTCACACATTAGAGACCTAACAACAGAGCACAAACACTGATGGACACCTCTCAGAAAAACTTGCTTTCCTTTCCTTTGGTTTTGTTTTGTTTTCTAACCTTGTGTCACTTTTGCTCTTTATCCCAGTCGCATTCTCTTTGACTGTTTCCCATTTATTTGCTTTGACGTTCTTTCTTTTTATATATACACTGTCTGGGCAAAGTAGAACCGATCATTGAAATAACAAGTCATTGAGGAGTATTTTGATCATATTAGGACAAGGAGCAATAGGTCAAGACTTTTTTGTAGGATACAGAACCTTCTGTGGTGGCCTTATCTAGCATTACATGTAGTTCTAAGTTAGACTGTCTATCCTGGAGACCTTATATGTAGAGTGTCATTTTCATTCTGATGTGGATTAACCACAAACAGGCTTTATGGCCAATTAAAAGAATTCTCCTCCAAAGAGGGGCCCAATGAACTAGAATATCGGGAAGCTGTAGGAGATACAGTCCATTCACACAAGCTGTCTCCTATCCATCATGCTTTTTTTATATTCTCCTAAATGTGCTTATTGAAATCTCCCATCTGGAAAGGTCACGGTTCCATTTTAGAAGGCAGGGTATTAATAATTGACGGGCAAGTTCTGCCTCTCGTTGTGTCAGAGCAGCTTGCATTTAAGTACCGCTCGCTTGAATAGGGCCACTACGGACAATTCTGTGATTCAACAGTATGGATTATGCATGCCGCAGCCTTTCCAGCAGCGATATAAACTTTCTGAAGGTCAGTAGTGTCAGACATATTGGCTATGAATATTTGGCTGTGAGCGTGTTTGCCGCATACAGATTACAGCGTGTATATGTATTATGGGACATACTGTATTAATGCAAGGGTTTGACCAGACAGTGTATATACCAGAGTTATTATTATTATTACTTTTTTTTTTTCTTTT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     4     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     4     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     2     3     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                                                       ...PROTEIN --- Ce ---- 3e-008     NP_001024582.1 High Incidence of Males (increased X chromosome loss) family member (him-4) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ag ---- 1e-008     XP_001688782.1 AGAP006083-PB [Anopheles gambiae str. PEST] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 6e-011     NP_724220.2 Leukocyte-antigen-related-like CG10443-PB, isoform B [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-011     XP_001186738.1 PREDICTED: similar to OTTHUMP00000065631 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-050     XP_688004.2 PREDICTED: leucine rich repeat neuronal 3 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xt ---- 3e-067     NP_001106456.1 hypothetical protein LOC100127637 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 1e-129     NP_001124166.1 leucine rich repeat neuronal 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-138     NP_032542.1 leucine rich repeat protein 1, neuronal [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 4e-139     NP_065924.3 leucine rich repeat neuronal 1 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bt ---- 2e-139     NP_001074207.1 leucine rich repeat neuronal 1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 8e-141     XP_541797.2 PREDICTED: similar to Leucine-rich repeats neuronal protein 1 precursor (NLRR-1) [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 8e-143     NP_001091008.1 leucine rich repeat neuronal 1 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 3e-174     NP_001079994.1 neuronal leucine-rich repeat protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL452g09ex.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---TAA---------TAG---------------------------ATG------------------------------------------------------------------------------------------------TGA---------------------TGA------------------------------------------------------------------TGA---------TGA------TAG------------TAG---------------TAG------------------------------------------------------------------------------ATGTAG------------------ATG---------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------TAA------------TGA------------------------TGA---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Ga15                               XL452g09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTATGTTCTGTGCTTTACCCCCTGAGTACCGTGGGCAACCTGTAAAGGAAGCATTGGCTCAAGACCCTGCAGGAGAGCAGTGTCTGCCCATGATCTCCCAAGATACATTTCCCAGTCACCTCAGCCTGGACATAGGGATGACCATCTCACTAGATTGCAGGGCAACAGCAGAGCCTGAACCAGAAATATACTGGGTAACTCCTTTGGGGCATAAAGTGACTTTGGAAACTCTTTCTGACAAGTACCACTTAAGTGGAGAGGGCAGTTTGCAGATTTTTAATGTGCAGGTGGAGGATTCTGGACGTTACACGTGTGTGGCGCAGAATTCAGAAGGAGCAGATACAAAGGTAGCCACCCTGAGAGTAAATGGAACCTTGTTAGATGGCACACAAGCTCTTAGACTCTATGTTCAACAAGCAGAATCCAGTTCAGTCTTGGTATCATGGAAAGTTAGTTCAAGTGTTTTGGCTTCTAACCTTAAGTGGTCTTCGGCCACTATGAAGATTGATAACCCCCATATCACTTATACAGCACGTGTGCCAGCGGATGTCCACGAGTATAATCTCACCCATCTCCAGCCAGCCACTGAATATGAAGTGTGCCTGACGGTGTCGGGGCTACACCAACAAGCTCAGCGTGCCTGCATCAATGTCACCACTAAAGGCACGTCCTACTCGTTGACTGTTACTGATCAGGAGACCAGTGCTGCCCTGGCTGCCGTCATGGGTTCCCTATTCGCCCTAATAAGTTTTGCCTCTGTTTCTGTTTATGCCGCCNA
  5   1   2       bld Emb4      out                   IMAGE:4960008.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAAGCATTGGCTCAAGACCCTGCAGGAGAGCAGTGTCTGCCCATGATCTCCCAAGATACATTTCCCAGTCACCTCAGCCTGGACATAGGGATGACCATCTCACTAGATTGCAGGGCAACAGCAGAGCCTGAACCAGAAATATACTGGGTAACTCCTTTGGGGCATAAAGTGACTTTGGAAACTCTTTCTGACAAGTACCACTTAAGTGGAGAGGGCAGTTTGCAGATTTTTAATGTGCAGGTGGAGGATTCTGGACGTTACACGTGTGTGGCGCAGAATTCAGAAGGAGCAGATACAAAGGTAGCCACCCTGAGAGTAAATGGAACCTTGTTAGATGGCACACAAGCTCTTAGACTCTATGTTCAACAAGCAGAATCCAGTTCAGTCTTGGTATCATGGAAAGTTAGTTCAAGTGTTTTGGCTTCTAACCTTAAGTGGTCTTCGGGCACTATGAAGATTGATAACCCCCATATCACTTATACAGCACGTGTGCCAGCGGATGTCCACGAGTATAATCTCACCCATCTCCCGCCAGCCACTGAATATGAAGTGTGCCTG
  5   1   2       bld Ga18                               xlk74i08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATCTCCCAAGATACATTTCCCAGTCACCTCAGCCTGGACATAGGGATGACCATCTCACTAGATTGCAGGCAACAGCAGNNNTGAACCAGAAATATACTGGGTAACTCCTTTGGGGCATAAAGTGACTTTGGAAACTCTTTCTGACAAGTACCACTTAAGTGGAGAGGGCAGTTTGCAGATTTTTAATGTGCAGGTGGAGGATTCTGGACGTTACACGTGTGTGGCGCAGAATTCAGAAGGAGCAGATACAAAGGTAGCCACCCTGAGAGTAAATGGAACCTTGTTAGATGGCACACAAGCTCTTAGACTCTATGTTCAACAAGCAGAATCCAGTTCAGTCTTGGTATCATGGAAAGTTAGTTCAAGTGTTTTGGCTTCTAACCTTAAGTGGTCTTCAGCCACTATGAAGATTGATAACCCCCATATCACTTATACAGCACGTGTNNCAGCGGATGTCCACGAGTATAATCTCACCCATCTCCAGCCAGCCACTGAATATGAAGTGTGCCTGACGGTGTCGGGGCTACACCAACAAGCTCAGCGTGCCTGCATCAATGTCACCACTAAAGGCACGTCCTACTCGTTGACTGTTACTGATCAGGAGACCAGTGCTGCCCTGNNTGCCGTCATGGGTTCCCTATTCGCCCTAATAAGNTTTGCCTCTGTTTCTGTTTATGCCGCCAAGAGGNTCCAGAGAAAGAATTATCGCCACTCGTTGAAGAAG
  5   1   2      seed Em10                            IMAGE:7983107.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAAGTTAGTTCAAGTGTTTTGGCTTCTAACCTTAAGTGGTCTTCGGCCACTATGAAGATTGATAACCCCCATATCACTTATACAGCACGTGTGCCAGCGGATGTCCACGAGTATAATCTCACCCATCTCCAGCCAGCCACTGAATATGAAGTGTGCCTGACGGTGTCGGGGCTACACCAACAAGCTCAGCGTGCCTGCATCAATGTCACCACTAAAGGCACGTCCTACTCGTTGACTGTTACTGATCAGGAGACCAGTGCTGCCCTGGCTGCCGTCATGGGTTCCCTATTCGCCCTAATAAGTTTTGCCTCTGTTTCTGTTTATGCCGCCAAGAGGTTCCAGAGAAAGAATTATCGCCACTCGTTGAAGAAGTATATGCAAAAGACCTCATCCATTCCACTCAACGAGCTTTATCCTCCTCTCATAAGCCTGTGGGAGGGAGACAGCGAAAAAGAAAAAGAGGGGACAGCAGAATCGAAAGCTTCCCAGGTGGACACATCCCGGAGCTATTACATGTGGTAACTCACACATTAGAGACCTAACAACAGAGCACAAACACTGATGGACACCTCTCAGAAAAacttgctttcctttcctttggttttgttttgttttctaaccctgtgtcacttttgCTCTTTATCCCAGTCGCATTCTCTTTGACTGTTTCCAATTTTTTGCTTT
  5   1   2       bld Tbd7      out                        XL106j15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGTTTTGGCTTCTAACCTTAAGTGGTCTTCAGCCACTATGAAGATTGATAACCCCCATATCACTTATACAGCACGTGTGCCAGCGGATGTCCACGAGTATAATCTCACCCATCTCCAGCCAGCCACTGAATATGAAGTGTGCCTGACGGTGTCGGGGCTACACCAACAAGCTCAGCGTGCCTGCATCAATGTCACCACTAAAGGCACGTCCTACTCGTTGACTGTTACTGATCAGGAGACCAGTGCTGCCCTGGCTGCCGTCATGGGTTCCCTATTCGCCCTAATAAGTTTTGCCTCTGTTTCTGTTTATGCCGCCAAGAGGTTCCAGAGAAAGAATTATCGCCACTCGTTGAAGAAGTATATGCAAAAGACCTCATCCATTCCACTCAATGAGCTTTATCCTCCTCTCATAAGCCTGTGGGAGGGAGACAGCGAAAAAGAAAAAGAGGGGACAGCAGA
  5   1   2       bld Emb4                            IMAGE:5570408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTATGCCGCCAAGAGGTTCCAGAGAAAGAATTATCGCCACTCGTTGAAGAAGTATATGCAAAAGACCTCATCCATTCCACTCAACGAGCTTTATCCTCCTCTCATAAGCCTGTGGGAGGGAGACAGCGAAAAAGAAAAAGAGGGGACAGCAGAATCGAAAGCTTCCCAGGTGGACACATCCCGGAGCTATTACATGTGGTAACTCACACATTAGAGACCTAACAACAGAGCACAAACACTGATGGACACCTCTCAGAAAAActtgctttcctttcctttggttttgttttgttttctaaccttgtgtcacttttgCTCTTTATCCCAGTCGTATTCTCTTTGACTGCTTCCCATTTATTTGCTTTGACGTTCTTTCTTTTTATATATACACTGCCCTGGGGCAAAGTAGAAACGATCCATTGAACATAACAAGTCATTGAGGAGTAATTCTCGATCATATTACGACCAGGAGCAATAGGTCCACGACCTTTTTTTGCACGATACAGAACCTTTCCCGGGGTGGCCTTTATCTAGCCATTACCCTTGTTACCTCTAACGTTAACACTGTCCTATCCCTGGAAGAACCTTCATATGGTAGAGGCGGCCATTTTCTAATTTCCCCGATGTGGGACTCACACCCATAAAAAGGGGTTTTCTATGGGGCCAATCTTAAAAAGGAATTCTTCCCCTCCCACACCAGGGGGCCCCGATGGAAACCTTAGAACATATCCGCGGAGCCGCTGCACCGTAAGACTAAAGGCGCCATTCTCCCACCAAAGACTGGGTCGTCTTTACCCCGCTTACGGCCCCCCCTTTTAAAAAATGCTCACCGTAACCCGGTGGGCCTCAATCGCAAATATCCCCCCGCATTCCCGGAACAACGGGCCCACACGGCGTACCCGTTTTTTAACAAAGGGGCGGGCCTTTATTTAACATACATGTTGGAAGGCGGCGAACCAGCTCCGTGGCCCTTCCCCGGTCCTGGGAGCGTGCGAAGCGCACCCTTGTTCAGTTTTCACCAATCCCGCCGC
  5   1   2       bld Tbd7      out                        XL081m10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCAACGAGNCTTTATCCTCCTCTCATAAGCCTGTGGGAGGGAGACAGCGAAAAAGAAAAAGAGGGGACAGCAGAATCGAAAGCTTCCCAGGTGGACACATCCCGGAGCTATTACATGTGGTAACTCACACATTAGAGACCTAACAACAGAGCACAAACACTGATGGACACCTCTCAGAAAAACTTGctttcctttcctttggttttgttttgttttctaaccttgtgtcacttttgctctttATCCCAGTCGCATTCTCTTTGACTGTTTCCCATTTATTTGCTTTGACGTTCTTTCTTTTTATATATACACTGTCTGGGCAAAGTAGAACCGATCATTGAAATAACAAGTCATTGAGGAGTATTTTGATCATATTAGGACAAGGAGCAATAGGTCAAGACTTTTTTGTAGGATACAGAACCTTCTGTGGTGGCCTTATCTAGCATTACATGTAGTTCTAAGTTAGACTGTCTATCCTGGAGACCTTATATGTAGAGTGTCATTTTCATTCTGATGTGGATTAACCACAAACAGGCTTTATGGC
  5   1   2       bld Neu7      out                        XL015l08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTTATCCTCCTCTCATAAGCCTGTGGGAGGGAGACAGCGAAAAAGAAAAAGAGGGGACAGCAGAATCGAAAGCTTCCCAGGTGGACACATCCCGGAGCTATTACATGTGGTAACTCACACATTAGAGACCTAACAACAGAGCACAAACACTGATGGACACCTCTCAGAAAAACTTGctttcctttcctttggttttgttttgttttcTAACCTTGTGTCACTTTTGCTCTTTATCCCAGTCGCATTCTCTTTGACTGTTTCCCATTTATTTGCTTTGACGTTCTTTCTTTTTATATATACACTGTCTGGGCAAAGTAGAACCGATCATTGAAATAACAAGTCATTGAGGAGTATTTTGATCATATTAGGACAAGGAGCAATAGGTCAAGACTTTTTTGTAGGATACAGAACCTTCTGTGGTGGCCTTATCTAGCATTACATGTAGTTCTAAGTTAGACTGTCTATCCTGGAGACCTTATATGTAGAGTGTCATTTTCATTCTGATGTGGATTAACCACAAACAGGCTTTATGGCCAATTAAAAGAATTCTCCTCCAAAGAGGGGCCCAATGAACTAAATATCGGGAAGCTGTAGGAGATACAGTCCATTCACACAAGCTGTCTCCTATCCATCATGCTTTTTTTATATTCTCCTAAATGTGCTTATTGAAATCTCCCATCT
  5   1   2       bld DMZ       out                        xl313p17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGATTCGAATTCGCACGAGGGTCATTGAGGAGTATTTTGATCATATTAGGACAAGGAGCAATAGGTCAAGACTTTTTTGTAGGATACAGAACCTTCTGTGGTGGCCTTATCTAGCATTACATGTAGTTCTAAGTTAGACTGTCTATCCTGGAGACCTTATATGTAGAGTGTCATTTTCATTCTGATGTGGATTAACCACAAACAGGCTTTATGGCCAATTAAAAGAATTCTCCTCCAAAGAGGGGCCCAATGAACTAGAATATCGGGAAGCTGTAGGAGATACAGTCCATTCACACAAGCTGTCTCCTATCCATCATGCTTTTTTTATATTCTCCTAAATGTGCTTATTGAAATCTCCCATCTGGAAAGGTCACGGTTCCATTTTAGAAGGCAGGGTATTAATAATTGACGGGCAAGTTCTGCCTCTCGTTGTGTCAGAGCAGCTTGCATTTAAGTACCGCTCGCTTGAATAGGGCCACTACGGACAATTCTGTGATTCAACAGTATGGATTATGCATGCCGCAGCCTTTCCAGCAGCGATATAAACTTTCTGAAGGTCAGTAGTGTCAGACATATTGGCTATGAATATTTGGCTGTGAGCGTGTTTGCCGCATACAGATTACAGCGTGTATATGTATTATGGGACATACTGTATTAATGCAAGGGTTTGACCAGACAGTGTATATACCAGAGTTATTATTATTATTACttttttttttcctttttGGA
  5   1   2       bld Tbd7      out                        XL108h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGCCCAATGAACTAGAATATCGGGAAGCTGTAGGAGATACAGTCCATTCACACAAGCTGTCTCCTATCCATCATGCTTTTTTTATATTCTCCTAAATGTGCTTAGTGAAATCTCCCATCTGGAAAGGTCACGGTTCCATTTTAGAAGGCAGGGTATTAATAATTGACGGGCAAGTTCTGCCTCTCGTTGTTTCAGAGCAGCTTGCATTTAAGTACCGCTCGCTTGAATAGGGCCACTACGGACAATTCTGTGATTCAACAGTATGGATTATGCATGCCGCAGCCTTTCCAGCAGCGATATAAACTTTCTGAAGGTCAGTAGTGTCAGACATATTGGCTATGAATATTTGGCTGTGAGCGTGTTTGCCGCATACAGATTACAGCGTGTATATGTATTATGGGACATACTGTATTAATGCAAGGGTTTGACCAGACAGTGTATATACCAGAGTTATTATTATTATTACtttttttttttCTTTTNGGACTTTGCTGTTTGATCGCA
  5   1   2      shim Tbd7      out                        XL083i04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGCTGTCTCCTATCCATCATGCTTTTTTTATATTCTCCTAAATGTGCTTATTGAAATCTCCCATCTGGAAAGGTCACGGTTCCATTTTAGAAGGCAGGGTATTAATAATTGACGGGCAAGTTCTGCCTCTCGTTGTGTCAGAGCAGCTTGCATTTAAGTACCGCTCGTTTGAATAGGGCCACTACGGACAATTCTGTGATTCAACAGNNTGGATTATGCATGCCGCAGCCTTTCCAGCAGCGATATAAACTTTCTGAAGGTCAGTAGTGTCAGACATATTGGCTATGAATATTTGGCTGTGAGCGTGTTTGCCGCATACAGATTACAGCGTGTATATGTATTATGGGACATACTGTATTAATGCAAGGGTTTGACCAGACAGTGTATATACCAGAGTTATTATTATTATTACtttttttttttCTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)