Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4964926.3                       4 END     1          33       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:4055125-IMAGp.5.5              26 PI      91        210      924                sec14l1-prov protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012783272 Xl3.1-IMAGE:7009593.5 - 3 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7009593.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTTTTGCGCTTGTGCGACTTGGTCAACCGGCTGTTCTGTGGAACCGGGGCCCCGGCTGTGCTCGAGACGGACCTCGTCTGCACATAAAGATGTGTTACATGGAACTGTTACACGTATGATCACCCACCTTTACTGCCAACTAACCTGGAACTTTATGAAGATTCCTTTTAGGTAATTTCCCTGTAAAGCAGGAAGCGTAGCAAAGGGGTAACTAACGTGCCAAAAAGAACAAGCAACCATGGTGCAGAAATACCAGTCACCCGTCCGCGTGTATAAACATGGCTTTGAGCTGATTATGGCCGCGTATGTGCGTCGTTTCCCCACCTGCCCCCTTATCCCCATGTTTGTTGGCAGCGATCTAATGAGCGAATACAAGAGTGAGGATGGAGCTGTACATATCATGGAGAGACGCTGCAAGCTGGATGTGGATGCGCCGCGCCTCTTGAAGAAAATTGCTGGAGTGGATTATGTTTACTTTATCCAGAAGAACTCTCTAAATCGCCAGGAACGTACTCTGCACATTGAGTCTTACAATGAGTCGTTCTCTAGCCGGATTATCATCAATGAGCACTGCTGTTACACTGTACACCCTGATAATGAAAACTGGACTTGCTTCGAACAGTCGGCTAGCCTGGATATCAAGTCCTTCTTTGGATTTGAGAGCACTGTGGAAAAGATTGCAATGAAGCAATACACAACAAACATAAAAAAGGGTAAAGAAATCATTGAGTATTACTTGAACCAGTTGGAGCAGGAGGGTATCACCTCCATGCCTCGCTGGACTCCTGAAATTGCTCAGCAGCAAGAAACCAAACAGATACCTCAGGCCCGGGCATGTCTCCTCCTCAGAGCATACCCACCAAATCTGCCGATGGGCCCAGCAGCAAGGGATGGCTTANCATCCAGCCCCACCTGCTGCAA
                                                  Xl3.1-CHK-1012710412                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCGCTTGTGCGACTTGGTCAACCGGCTGTTCTGTGGAACCGGGGCCCCGGCTGTGCTCGAGACGGACCTCGTCTGCACATAAAGATGTGTTACATGGAACTGTTACACGTATGATCACCCACCTTTACTGCCAACTAACCTGGAACTTTATGAAGATTCCTTTTAGGTAATTTCCCTGTAAAGCAGGAAGCGTAGCAAAGGGGTAACTAACGTGCCAAAAAGAACAAGCAACCATGGTGCAGAAATACCAGTCACCCGTCCGCGTGTATAAACATGGCTTTGAGCTGATTATGGCCGCGTATGTGCGTCGTTTCCCCACCTGCCCCCTTATCCCCATGTTTGTTGGCAGCGATCTAATGAGCGAATACAAGAGTGAGGATGGAGCTGTACATATCATGGAGAGACGCTGCAAGCTGGATGTGGATGCGCCGCGCCTCTTGAAGAAAATTGCTGGAGTGGATTATGTTTACTTTATCCAGAAGAACTCTCTAAATCGCCAGGAACGTACTCTGCACATTGAGTCTTACAATGAGTCGTTCTCTAGCCGGATTATCATCAATGAGCACTGCTGTTACACTGTACACCCTGATAATGAAAACTGGACTTGCTTCGAACAGTCGGCTAGCCTGGATATCAAGTCCTTCTTTGGATTTGAGAGCACTGTGGAAAAGATTGCAATGAAGCAATACACAACAAACATAAAAAAGGGTAAAGAAATCATTGAGTATTACTTGAACCAGTTGGAGCAGGAGGGTATCACCTCCATGCCTCGCTGGACTCCTGAAATTGCTCAGCAGCAAGAAACCAAACAGATACCTCAGGCCCGGGCATGTCTCCTCCTCAGAGCATACCCACCAAATCTGCCGATGGGCCCAGCAGCAAGGGATGGCTTANCATCCAGCCCCACCTGCTGCAACCCCAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     241     788                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     241     112                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     241     841                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     241      34                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dm ==== 4e-061     NP_609028.2 CG9528-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 8e-062     XP_001191893.1 PREDICTED: similar to Sec14l1 protein [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Ce ==== 2e-064     NP_001040876.1 T23G5.2b [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 2e-075     XP_001256666.2 PREDICTED: similar to SEC14-like 5 [Bos taurus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 2e-085     NP_957392.1 SEC14-like 1 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Mm ==== 1e-092     NP_083053.1 RIKEN cDNA 1200017E04 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Bt ==== 8e-093     NP_001095445.1 SEC14 (S. cerevisiae)-like 1 [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Cf ==== 1e-094     XP_540457.2 PREDICTED: similar to SEC14-like protein 1 isoform 1 [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 1e-094     NP_001034662.1 SEC14 (S. cerevisiae)-like 1 isoform b [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Gg ==== 3e-095     XP_415614.1 PREDICTED: similar to SEC14-like protein 1 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 4e-113     NP_001007910.1 sec14l1-prov protein [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 7e-116     NP_001087870.1 MGC81931 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:7009593.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------ATG---------------TAA---------------------------------TAA---------------------------ATG------------------------------------------------------ATG------------------------------------------ATG------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2       bld Egg6 5g3  out                   IMAGE:4412786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTTTTGCGCTTGTGCGACTTGGTCAACCGGCTGTTCTGTGGAACCGGGGCCCCGGCTGTGCTCGAGACGGACCTCGTCTGCACATAAAGATGTGTTACATGGAACTGTTACACGTATGATCACCCACCTTTACTGCCAACTAACCTGGAACTTTATGAAGATTCCTTTTAGGTAATTTCCCTGTAAAGCAGGAAGCGTAGCAAAGGGGTAACTAACGTGCCAAAAAGAACAAGCAACCATGGTGCAGAAATACCAGTCACCCGTCCGCGTGTATAAACATGGCTTTGAGCTGATTATGGCCGCGTATGTGCGTCGTTTCCCCACCTGCCCCCTTATCCCCATGTTTGTTGGCAGCGATCTAATGAGCGAATACAAGAGTGAGGATGGAGCTGTACATATCATGGAGAGACGCTGCAAGCTGGAT
  5   1   2      seed Kid  5g                         IMAGE:7009593.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCGGGGCCCCGGCTGTGCTCGAGACGGACCTCGTCTGCACATAAAGATGTGTTACATGGAACTGTTACACGTATGATCACCCACCTTTACTGCCAACTAACCTGGAACTTTATGAAGATTCCTTTTAGGTAATTTCCCTGTAAAGCAGGAAGCGTAGCAAAGGGGTAACTAACGTGCCAAAAAGAACAAGCAACCATGGTGCAGAAATACCAGTCACCCGTCCGCGTGTATAAACATGGCTTTGAGCTGATTATGGCCGCGTATGTGCGTCGTTTCCCCACCTGCCCCCTTATCCCCATGTTTGTTGGCAGCGATCTAATGAGCGAATACAAGAGTGAGGATGGAGCTGTACATATCATGGAGAGACGCTGCAAGCTGGATGTGGATGCGCCGCGCCTCTTGAAGAAAATTGCTGGAGTGGATTATGTTTACTTTATCCAGAAGAACTCTCTAAATCGCCAGGAACGTACTCTGCACATTGAGTCTTACAATGAGTCGTTCTCTAGCCGGATTATCATCAATGAGCACTGCTGTTACACTGTACACCCTGATAATGAAAACTGGACTTGCTTCGAACAGTCGGCTAGCCTGGATATCAAGTCCTTCTTTGGATTTGAGAGCACTGTGGAAAAGATTGCAATGAAGCAATACACAACAAACATAAAAAAGGGTAAAGAAATCATTGAGTATTACTTGAANCCAGTGGAGCAGGAGGGTATCACCTCCATGCCTCGCTGGACTCCTGAAATGCTCAGCA
  5   1   2       bld Te2N 5g                         IMAGE:7204276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTGTGCTCGAGACGGACCTCGTCTGCACATAAAGATGTGTTACATGGAACTGTTACACGTATGATCACCCACCTTTACTGCCAACTAACCTGGAACTTTATGAAGATTCCTTTTAGGTAATTTCCCTGTAAAGCAGGAAGCGTAGCAAAGGGGTAACTAACGTGCCAAAAAGAACAAGCAACCATGGTGCAGAAATACCAGTCACCCGTCCGCGTGTATAAACATGGCTTTGAGCTGATTATGGCCGCGTATGTGCGTCGTTTCCCCACCTGCCCCCTTATCCCCATGTTTGTTGGCAGCGATCTAATGAGCGAATACAAGAGTGAGGATGGAGCTGTACATATCATGGAGAGACGCTGCAAGCTGGATGTGGATGCGCCGCGCCTCTTGAAGAAAATTGCTGGAGTGGATTATGTTTACTTTATCCAGAAGAACTCTCTAAATCGCCAGGAACGTACTCTGCACATTGAGTCTTACAATGAGTCGTTCTCTAGCCGGATTATCATCAATGAGCACTGCTGTTACACTGTACACCCTGATAATGAAAACTGGACTTGCTTCGAACAGTCGGCTAGCCTGGATATCAAGTCCTTCTTTGGATTTGAGAGCACTGTGGAAAAGATTGCAATGAAGCAATACACAACAAACATAAAAAAGGGTAAAGAAATCATTGAGTATTACTTGAACCAGTTGGAGCAGGAGGGTATCACCTCCATGCCTCGCTGGACTCCTGAAATTGCTCAGCAGCAAGAAACCAAACAGATACCTCAGGCCCGGGCATGTCTCCTCCTCAGAGCATACCCACCAAATCTGCCGATGGGCCCAGCAGCAAGGGATGGCTTANCATCCAGCCCCACCTGCTGCAACCCCAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)