Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012783466 Xl3.1-IMAGE:8077326.5 - 5 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8077326.5                     GTCCCTTCTAGTGGGTGCTAATCAAACACATCCCCTTTCTATTGCATTCAGTCACACCTTGATCCCACAAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGACATGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGTTCAACCTGCGACAACGGTTCACCCAAAAAAGGTAGAGGGACTTCGGGCAAGAGGAGAAAAGCCTCCAGCAAGAAAAGTCCACTGGGCACCATCAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTCTGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCAGAAAACGACCTCAAGGAAGTGGTGAGCACTAGCCGATTGTGTGGTCCCACGGCATCTTGACCCATCCAGTGGCCCTGGATGTAAAGACTCTCGCCAGTGGGAGCTCCCTGCTTTGCAGAACAAACTGGGATAAGTCAGCCAGAAAAAAAGACCNAATGTACATAAGACTCATCCTAAGCAAAG
                                                  Xl3.1-CHK-1012704607                           TCTAGTGGGTGCTAATCAAACACATCCCCTTTCTATTGCATTCAGTCACACCTTGATCCCACAAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGACATGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGTTCAACCTGCGACAACGGTTCACCCAAAAAAGGTAGAGGGACTTCGGGCAAGAGGAGAAAAGCCTCCAGCAAGAAAAGTCCACTGGGCACCATCAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTCTGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCAGAAAACGACCTCAAGGAAGTGGTGAGCACTAGCCGATTGTGTGGTCCCACGGCATCTTGACCCATCCAGTGGCCCTGGATGTAAAGACTCTCGCCAGTGGGAGCTCCCTGCTTTGCAGAACAAACTGGGATAAGTCAGCCAGAAAAAAAGACCNAATGTACATAAGACTCATCCTAAGCAAAGATTCCC
                                                      consensus depths                          2     2     2     2     2     2     2     2     2     2     2     2     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4
                                               BLH ATG      93     208                     
                                               BLH MIN      93      85                     
                                               BLH OVR      93     303                     
                                               ORF LNG      93       8                     
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074639.5p GAAAACACTGGCACAGGCGTGTCCCTTCTAGTGGGTGCTAATCAAACACATCCCCTTTCTATTGCATTCAGTCACACCTTGATCCCACAAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGACATGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGTTCAACCTGCGACAACGGTTCACCCAAAAAAGGTAGAGGGACTTCGGGCAAGAGGAGAAAAGCCTCCAGCAAGAAAAGTCCACTGGGCACCATCAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTCTGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCATTAACCTGACTTGCCCTTTATGGTGGCTGGAAACCAGAAACGACCTCAGGAATGGGAGCACTAGCCGATGTGTGGCCACGGCTCTGACCATCAGTGCCTGGATGTAGACCCGCAGTGGACTCCTGCTTCGACAACTGGATATCGCAGAAAAAACAATGTCTAATCTCTAGCAGATCCTCTCATACTTGCTC
  5   1   2      seed FaBN 5x3                        IMAGE:8077326.5p                     GTCCCTTCTAGTGGGTGCTAATCAAACACATCCCCTTTCTATTGCATTCAGTCACACCTTGATCCCACAAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGACATGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGTTCAACCTGCGACAACGGTTCACCCAAAAAAGGTAGAGGGACTTCGGGCAAGAGGAGAAAAGCCTCCAGCAAGAAAAGTCCACTGGGCACCATCAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTCTGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCAGAAAACGACCTCAAGGAAGTGGTGAGCACTAGCCGATTGTGTGGTCCCACGGCATCTTGACCCATCCAGTGGCCCTGGATGTAAAGACTCTCGCCAGTGGGAGCTCCCTGCTTTGCAGAACAAACTGGGATAAGTCAGCCAGAAAAAAAGACCNAATGTACATAAGACTCATCCTAAGCAAAGATTCACTT
  5   1   2       bld FaB  5x3                        IMAGE:8073050.5p                                                                                         AAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGACATGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGTTCAACCTGCGACAACGGTTCACCCAAAAAAGGTAGAGGGACTTCGGGCAAGAGGAGAAAAGCCTCCAGCAAGAAAAGTCCACTGGGCACCATCAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTCTGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCAGAAAACGACCTCAAGGAAGTGGTGAGCACTAGCCGATTGTGTGGTCCCACGGCATCTTGACCCATCCAGTGGCCCTGGATGTAAAGACTCTCGCCAGTGGGAGCTCCCTGCTTTGCAGAACAAACTGGGATAAGTCAGCCAGAAAAAAAGACCAAATGTACATAAGACTCATCCTAAGCAAAGATTCCACTTTCTCTATTTATCT
  5   1   2       bld Sp1  5x3                        IMAGE:5512805.5p                                                                                           GGAAGGAGCAGCATAACAGATCATNGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGACATGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGTTCAACCTGCGACAACGGTTCACCCAAAAAAGGTAGAGGGACTTCGGGCAAGAGGAGAAAAGCCTCCAGCAAGAAAAGTCCACTGGGCACCATCAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTCTGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCAGAAAACGACCTCAAGGAAGTGGTGAGCACTAGCCGATTGTGTGGTCCCACGGCATCTTGACCCATCCAGTGGCCCTGGATGTAAAGACTCTCGCCAGTGGGAGCTCCCTGCTTTGCAGAAACAACTGGGATAAGTCAGCCAGAANAAAAGACCNAATGTACATAAGACTCATCCTAAGCAAAGATTCCCACTTCTCTATTTATCTTTTTGCCCTCCNNTCATTCATTCCCNAGAGCCNTGCTGGGGTCAGGCTTTNCTGCATTNGTACGTATGTAATAATGGGGGATCN
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074639.3p                                                                                                                                                                                                                                                      AAGAGAGTCACTGCGACACGTTCACCAAAAAGTAGAGGATTCGGCAGAGGAGAAAGCCCCAGCAAGAAAGTCCACTGGGNCCATCACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTAAGCAAAGCCTCTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTATGCGGCTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAGTATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTCTATGGTGGCTGGAAAACCAGAAAACGACCTCAAGGAAGTGGTGAGCACTAGCCGATTGTGTGGTCCCACGGCATCTTGACCCATCCAGTGGCCCTGGATGTAAAGACTCTCGCCAGTGGGAGCTCCCTGCTTTGCAGAACAAACTGGGATAAGTCAGCCAGAAAAAAAAGACCAAATGTACATAAGACTCATCCTAAGCAAAGATTCCACTTTCTCTATTTATCTTTTTGCCTTCCTTCATCTCATTCCCAAGAGCCTTGTTGGTCCAAGAGCTTTCTTGCAATTTGTTACATGTATGTTAATAAATGGGGGGATACATGCTAGCTGGGTTTTTACAGTCATTGCCTTGGAAGAATTATTTTTTGCATATATATTTATATATATACATTATTAGATTTATATTAAAATTATAAANAAANANNA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)