Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 30 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.5    0Xl3.1-rxl262g18.3                           6 END     2          40       33                forkhead box D3 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL436h17ex.5                         51 PI      80        434      665                (no blast hit)
     3   0.0    0Xl3.1-xl316k02.3.5                         39 PI      79        434      674                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:7980965.5                       9 PI      89        421      674                (no blast hit)
     5   0.0    0Xl3.1-IMAGE:8318096.5                       7 PI      92         25      677                forkhead box D3 [Xenopus laevis]

 This cluster: approximate FL confidence score = 95%

 1012783660 Xl3.1-IMAGE:7979206.5 - 5 ESTs
                                                                       .........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7979206.5                    GCGCGTCCCTAGTCAAGCAGCAGCAGCAGCGGGCAACACGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGACAGAGCACTCACTGCAAGTTGTCTACTACTTGCCATACTGAGCCTCTTTCTATTCTCTGCCCCTCGCTGTGGAGTCTAAGCAGGGATGACCCTGTCAAGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATTGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCCCAGTCGGCCATCACGACGAAGTGGACGCGCTCGGGGGCAAGGAGATACCCAGGAGTCCCTCGGGCAGTAGCACTGATGCAGAGGGTAAGGGTGAGAGCCAACAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCGTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGGATCTGCGAGTTCATCAGCAGCCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCCCTTAATGACTGTTTCATCAAGATCCCCCGGGAGCCTGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCAGTCCGAG
                                                  Xl3.1-CHK-1012706098                          CCCTAGTCAAGCAGCAGCAGCAGCGGGCAACACGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGACAGAGCACTCACTGCAAGTTGTCTACTACTTGCCATACTGAGCCTCTTTCTATTCTCTGCCCCTCGCTGTGGAGTCTAAGCAGGGATGACCCTGTCAAGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATTGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCCCAGTCGGCCATCACGACGAAGTGGACGCGCTCGGGGGCAAGGAGATACCCAGGAGTCCCTCGGGCAGTAGCACTGATGCAGAGGGTAAGGGTGAGAGCCAACAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCGTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGGATCTGCGAGTTCATCAGCAGCCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCCCTTAATGACTGTTTCATCAAGATCCCCCGGGAGCCTGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCAG
                                                      consensus depths                         3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     4     5     5     5     5     5     4     5     4     5     3     5     3     5     2     5     3     5     2     5
                                               BLH ATG     166     335                    
                                               BLH MIN     166      84                    
                                               BLH OVR     166     701                    
                                               ORF LNG     166      16                    
  5   1   2       add Ga18 5g3  out                     xlk103b21ex.5p GGAATTTGAAAGTGTCTGCGCGTCCCTAGTCAAGCAGCAGAAGNAGCAGNAGNGNCAACACGGAGGAGGGAGGGGGCAATNNACAGGATTTGAAGACAGAGCACTCACTGCAAGTTGTCTACTACTTGCCATACTGAGCCTCTTTCTATTCTCTGCCCCTCGCTGTGGAGTCTAAGCAGGGATGACCCTGTCAAGCAGCGGCANTNCNGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATTGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGNNNNNNAGTCGGCCATCACGACNNANNNACGCGCTCGGGGGCAAGGAGATACCCAGGAGTCCCTCGGGCAGTAGCACTGATGCAGAGGGTAAGGGTGAGAGCCAACAGCAGCAGCAGGAGGNCATCCAGAACAAGCCCAAGAACAGCGTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGGANCTGCGAGTTCATCAGCAGCCNNTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGNNAGANCTCCATCCGCCACAACCTGTCCCTTAATGACTGTTTCATCAAGATCCCCCGGGAGNCTGGNAACCCAGGCAAGGNNAANTACTGGACCCTCGACCCCCAGTCCGAGGNNATGTTCGANA
  5   1   2       bld Em10 5g                         IMAGE:7979206.5p        TTGAAAGTGTCTGCGCGTCCCTAGTCAAGCAGCAGCAGCAGCGGGTAACACGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGACAGAGCACTCACTGCAAGTTGTCTACTACTTGCCATACTGAGCCTCTTTCTATTCTCTGCCCCTCGCTGTGGAGTCTAAGCAGGGATGACCCTGTCAAGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATTGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCCCAGTCGGCCATCACGACGAAGTGGACGCGCTCGGGGGCAAGGAGATACCCAGGAGTCCCTCGGGCAGTAGCACTGATGCAGAGGGTAAGGGTGAGAGCCAACAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCGTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGGATCTGCGAGTTCATCAGCAGCCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCCCTTAATGACTGTTTCATCAAGATCCCCCGGGAGCCTGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCAGTCCGAGGACATGTCGACATGGCAGTTTCCTCAGAGGAGAGCNGTTNAGAACAGCACAGACCGTGAGGAGCAACTGTCTCTGATCAAGCTGGGGCTATAGCTGCGTCTATGCGCATATGATCACGGCACTAATACTGTGCTGATTCTA
  5   1   2       add Lmb1 5g3  out                   IMAGE:8533074.5p        TTTGAAGTGTCTGCGCGTCCCTAGTCAAGCAGCAGCAGCAGCGGGCAACACGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGACAGAGCACTCACTGCAAGTTGTCTACTACTTGCCATACTGAGCCTCTTTCTATTCTCTGCCCCTCGCTGTGGAGTCTAAGCAGGGATGACCCTGTCAAGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATTGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCCCAGTCGGCCATCACGACGAAGTGGACGCGCTCGGGGGCAAGGAGATACCCAGGAGTCCCTCGGGCAGTAGCACTGATGCAGAGGGTAAGGGTGAGAGCCAACAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCGTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGGATCTGCGAGTTCATCAGCAGCCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCCCTTAATGACTGTTTCATNCAGATTCCCCGGAGCCCTGGCACTCAGGCAGGGCACTACTGGACCTCGACCCCAGTCGAAGACTGTCGACATGGCAGTTTCTCAGAGAGAGCGGTTAGAACGCACAGACCGTGAGGACGATGCTCCTGATCAGCTTGGGTATACTGCAGTCTTGCGCATAGATCACGGAGCAATACTGTGCGATACTAT
  5   1   2       bld Em10 5g                         IMAGE:8318381.5p                GTCTGCGCGTCCCTAGTCAAGCAGCAGCAGCAGCGGGCAACACGGAGGAGGGAGGGGGCAATGCACAGGATTTGAAGACAGAGCACTCACTGCAAGTTGTCTACTACTTGCCATACTGAGCCTCTTTCTATTCTCTGCCCCTCGCTGTGGAGTCTAAGCAGGGATGACCCTGTCAAGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATTGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCCCAGTCGGCCATCACGACGAAGTGGACGCGCTCGGGGGCAAGGAGATACCCAGGAGTCCCTCGGGCAGTAGCACTGATGCAGAGGGTAAGGGTGAGAGCCAACAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCGTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGTCCCCAGAAGAAGCTCACCCTGAGCGGGATCTGCGAGTTCATCAGCAGCCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCCCTTTAATGACTGTTTCATCAAGATCCCCCGGGAGCCTGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCAGTCCGAGGACATGTTCGACAATGGCAGTTTTCCTCAGGA
  5   1   2      seed Emb1 5g                         IMAGE:5156275.5p                                                                                                                                                            CTCGCTGTGGAGTCTAAGCAGGGATGACCCTGTCAAGCAGCGGCAGTGCCAGCGACATGTCCGGCCAGACCGTACTGAGCGCAGACGACGCGGACATTGATGTGGTGGGCGAGGGGGACGAGGCGCTGGACAAGGACAGTGAGTGCGAGAGCCCAGTCGGCCATCACGACGAAGTGGACGCGCTCGGGGGCAAGGAGATACCCAGGAGTCCCTCGGGCAGTAGCACTGATGCAGAGGGTAAGGGTGAGAGCCAACAGCAGCAGCAGGAGGGCATCCAGAACAAGCCCAAGAACAGCGTGGTGAAGCCCCCCTACTCGTACATCGCTCTCATCACCATGTCCATCCTACAGAGCCCCCAGAAGAAGCTCACCCTGAGCGGGATCTGCGAGTTCATCAGCAGCCGCTTCCCCTACTATCGGGAGAAGTTCCCGGCCTGGCAGAACTCCATCCGCCACAACCTGTCCCTTAATGACTGTTTCATCAAGATCCCCCGGGAGCCTGGCAACCCAGGCAAGGGCAACTACTGGACCCTCGACCCCCAGTCCGAGGACATGTTCGACAATGGCAGTTTCCTCAGGAGGAGGAAGCGGTTTAAGAGACAGCAGCAGGACACGTTGAGGGAGCAGACTGCTCTCATGATGCANAGCTTTGGGGCTTATAGCCTGGCCAGTCCCTATGGGCGCCACTATGGACTCCACCCGGCAGCCTACACTCACCCTGCTGCCCTGCAGTATCCTTATATTCCCCCAGTGGGACCCATGTTACCCCCGGNCGTGCCACTTCTGCCTTTCCTCTGAACTGACCAGGGAAagccttcagctcacagctcagccccagcctccagctgcaactcagcagcctcagNAGNACCGCCGCCTTCATTAATCAAGTCTGAGCCCAGCAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)