Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 26 Sep 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4408226.3                       5 END     2          28       40                LOC445880 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 89%

 1012783829 Xl3.1-IMAGE:6327373.5 - 7 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6327373.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATGACCAGCAGGGTGGCCCTGTCTTAAGGTCAGGTGCTCGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGCGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGCCGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGATTGTGCATATTACAGCAGGATTGGAGATAACCTGGGAGTCCTGACCCTGATCAAACGGCCATGGAGAAATTCCCCTCAATGCTAGATCCTGTGCGAAGGATTGTTTCTCTGCGTACGAGAAAGACGA
                                                  Xl3.1-CHK-1012700919                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGCAGGGTGGCCCTGTCTTAAGGTCAGGTGCTCGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGCGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGCCGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGATTGTGCATATTACAGCAGGATTGGAGATAACCTGGGAGTCCTGACCCTGxxxAAACGGCCATGGAGAAxTxCCCxxxAxTGCTAGATCCTGTGCGAAGGATTGTTTCTCTGCGTACGAGAAAGACGAAGCAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     6     3     6     3     6     3     6     3     6     3     6     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCATGAAGAGTTTAAAGTCCAGGCTGAAGAAACACGAAGTGACCATA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                               BLH ATG     102      96                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     135     114                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     171     215                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     171       9                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ci ---- 1e-015     NP_001037825.1 Notch [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-018     NP_001021269.1 UNCoordinated family member (unc-44) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 2e-021     XP_307908.3 AGAP002272-PA [Anopheles gambiae str. PEST] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-022     NP_651624.2 CG10011-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 5e-024     XP_001193458.1 PREDICTED: similar to ankyrin 2,3/unc44 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Dr ==== 6e-090     XP_001922633.1 PREDICTED: similar to uveal autoantigen with coiled-coil domains and ankyrin repeats [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 2e-104     NP_082559.1 nuclear membrane binding protein NUCLING [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 1e-108     NP_001008225.1 uveal autoantigen with coiled-coil domains and ankyrin repeats isoform 2 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 6e-111     XP_413937.2 PREDICTED: similar to uveal autoantigen with coiled-coil domains and ankyrin repeats [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Cf ==== 7e-113     NP_001003112.1 C3VS protein [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bt ==== 1e-113     NP_776634.1 uveal autoantigen with coiled-coil domains and ankyrin repeats [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 3e-129     CAJ82589.1 uveal autoantigen with coiled-coil domains and ankyrin repeats [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 2e-140     AAI06676.1 Unknown (protein for IMAGE:4407311) [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6327373.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA------------------------------------------------------------------------------------------------ATG---------------TGA------------------TGA---------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       bld He1  5g                         IMAGE:4407311.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAGGAGGGCAGAGAGTTACAGTGAAACATTCAGCAAAGTATTAGTGGAGGCATCTGCATCATGGACTCGCAATGACCAGCAGGGTGGCCCTGTCTTAAGGTCAGGTGCTCGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGTGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCT
  5   1   2       bld Emb4 5g                         IMAGE:4203409.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGTCCGCGCAATGACCAGCAGGGTGGCCCTGTCTTAAGGTCAGGTGCTCGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGCGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCATCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTC
  5   1   2       bld He1       out                   IMAGE:4408226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGCGTCCGGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGCGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGATTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGACGCACTGCTTTACATGATGCAGCC
  5   1   2      seed Egg3                            IMAGE:6327373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAATTCCCCCGGGGCAAAGTAGATTCTGCGAAAAGCCACAGGGGGAAAACTGTGAGGAACAAACGTTATTTCCATAGAATCCCAGCGGAAAAGCGTAATGTGTGGAGGGAGAGACACAAGGGAATCATGAAGAGTTTAAAGTCCAGGCTGAAGAAACACGAAGTGACCATAACACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGCCGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGACTGTGCATATTACAGCAGGATTGGAGATAACCTGGAGGTCCTGACCCTGATCAAAACGGCCATGGNAGAATTCCC
  5   1   2       bld Egg3                            IMAGE:6326931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCGGGAGCGGAAAGCGTATGTGTGGAGGGAGAGACACAAGGGAATCATGAAGAGTTTAAAGTCCAGGCTGAAGAAACACGAAGTGACCATAACACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGATTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGACGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGACTGTGCATATTACAGCAGGATTGGAGATAACCTGGGAGTCCTGACCCTGATCAAACGGCCATGGAGAAATTTCCCTCAGTGCTAGATCCTGTGCGAAGGATTGTTTCTCTGCGTACGAGAAAGACGAAAGCAAACTCGGTGGAAGGATGGTATTGTCGTGGTCTAAAGATAAGTCACTG
  5   1   2       bld Oo1                             IMAGE:6640396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCGGAAAAGCGAATGTGTGGAGGGAGAGACACAGGGAATCATGAAGAGTTTAAAGTCCAGGCTGAAGAAACACGAAGTGACCATAACACAAACGGCTGACTGGAATAAATATGATGAACGGTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGCCGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGATTGTGCATATTACAGCAGGATTGGAAATAAACCTGGAGGTCCTGACCCTGATCAAACGGCCATGGAGAATTCCCCTCAAGTGCTAGATCCTGGTGCGAAAGATTGTTTCTCTGCGTACGAGAAAGACGAAGCAAACTCGGTGGAAGAATGGTAGTGTCGTGTCTAAGATAAGTCACTGGATCTGGAAGCTGAAATGAGAACCTACGGGAGGAGGCTT
  5   1   2       bld Gas8      out                   IMAGE:3518012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCACAACCCAGCATCAGTGGGGTCTTATTCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGATTGTGCATATTACACAGGATTGGAGATAACCTGGAGGTCCTGACCCTGATCAAAACGGCCATGGAGAATTCCCCTCAAGTGCTAGATCCTGTGCGAAGGATTGTTTCTCTGCGTACGAGAAAGACGAAGCAAAACTCGGTGGAAGATGGTAGTGTCGTGTCTAAAGATAAGTCACTGGATCTGGAAGCTGAAAATGAGAACCTACGGGAGAGGCTTCGGAAAATACAACATGAGCAGAGAACTCTCTTTGAGAAAGTGGAGGGATTACAACATCAACTCAGCCAATTGATGTCTGATGACCTAGAAAATGAGAAGAGCATCTGAAAGCAATTCTAGAAGGaaaagaaaaaaaaCTGGAAGAATGTCTAAGAACCATGGAAAA

In case of problems mail me! (