Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:4408226.3                       5 END     2          28       40                LOC445880 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 89%

 1012783829 Xl3.1-IMAGE:6327373.5 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6327373.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATGACCAGCAGGGTGGCCCTGTCTTAAGGTCAGGTGCTCGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGCGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGCCGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGATTGTGCATATTACAGCAGGATTGGAGATAACCTGGGAGTCCTGACCCTGATCAAACGGCCATGGAGAAATTCCCCTCAATGCTAGATCCTGTGCGAAGGATTGTTTCTCTGCGTACGAGAAAGACGA
                                                  Xl3.1-CHK-1012700919                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGCAGGGTGGCCCTGTCTTAAGGTCAGGTGCTCGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGCGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGCCGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGATTGTGCATATTACAGCAGGATTGGAGATAACCTGGGAGTCCTGACCCTGxxxAAACGGCCATGGAGAAxTxCCCxxxAxTGCTAGATCCTGTGCGAAGGATTGTTTCTCTGCGTACGAGAAAGACGAAGCAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     6     3     6     3     6     3     6     3     6     3     6     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCATGAAGAGTTTAAAGTCCAGGCTGAAGAAACACGAAGTGACCATA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                               BLH ATG     102      96                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     135     114                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     171     215                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     171       9                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ci ---- 1e-015     NP_001037825.1 Notch [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-018     NP_001021269.1 UNCoordinated family member (unc-44) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ag ---- 2e-021     XP_307908.3 AGAP002272-PA [Anopheles gambiae str. PEST] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-022     NP_651624.2 CG10011-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 5e-024     XP_001193458.1 PREDICTED: similar to ankyrin 2,3/unc44 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Dr ==== 6e-090     XP_001922633.1 PREDICTED: similar to uveal autoantigen with coiled-coil domains and ankyrin repeats [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 2e-104     NP_082559.1 nuclear membrane binding protein NUCLING [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 1e-108     NP_001008225.1 uveal autoantigen with coiled-coil domains and ankyrin repeats isoform 2 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 6e-111     XP_413937.2 PREDICTED: similar to uveal autoantigen with coiled-coil domains and ankyrin repeats [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Cf ==== 7e-113     NP_001003112.1 C3VS protein [Canis familiaris] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bt ==== 1e-113     NP_776634.1 uveal autoantigen with coiled-coil domains and ankyrin repeats [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 3e-129     CAJ82589.1 uveal autoantigen with coiled-coil domains and ankyrin repeats [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 2e-140     AAI06676.1 Unknown (protein for IMAGE:4407311) [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6327373.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA------------------------------------------------------------------------------------------------ATG---------------TGA------------------TGA---------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  5   1   2       bld He1  5g                         IMAGE:4407311.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAGGAGGGCAGAGAGTTACAGTGAAACATTCAGCAAAGTATTAGTGGAGGCATCTGCATCATGGACTCGCAATGACCAGCAGGGTGGCCCTGTCTTAAGGTCAGGTGCTCGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGTGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCT
  5   1   2       bld Emb4 5g                         IMAGE:4203409.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGTCCGCGCAATGACCAGCAGGGTGGCCCTGTCTTAAGGTCAGGTGCTCGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGCGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCATCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTC
  5   1   2       bld He1       out                   IMAGE:4408226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACGCGTCCGGTGTGCCCTGCTCACAAGTCACAAGCCAAGTGACACTTGTCATCATGGCAGAAATGTGTCAATGGGGACGAGCGTTGCTTGACCGCACTGCGGGCTACTTTGACTAACTGAAAGACTAGTAGTGGCCAGAATGACTCGCTGGTTTGCCTGTTCTTCCAAACGCAAACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGATTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGACGCACTGCTTTACATGATGCAGCC
  5   1   2      seed Egg3                            IMAGE:6327373.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAATTCCCCCGGGGCAAAGTAGATTCTGCGAAAAGCCACAGGGGGAAAACTGTGAGGAACAAACGTTATTTCCATAGAATCCCAGCGGAAAAGCGTAATGTGTGGAGGGAGAGACACAAGGGAATCATGAAGAGTTTAAAGTCCAGGCTGAAGAAACACGAAGTGACCATAACACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGCCGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGACTGTGCATATTACAGCAGGATTGGAGATAACCTGGAGGTCCTGACCCTGATCAAAACGGCCATGGNAGAATTCCC
  5   1   2       bld Egg3                            IMAGE:6326931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCGGGAGCGGAAAGCGTATGTGTGGAGGGAGAGACACAAGGGAATCATGAAGAGTTTAAAGTCCAGGCTGAAGAAACACGAAGTGACCATAACACAAACGGCTGACTGGAATAAATATGATGAACGTTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGATTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGACGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGACTGTGCATATTACAGCAGGATTGGAGATAACCTGGGAGTCCTGACCCTGATCAAACGGCCATGGAGAAATTTCCCTCAGTGCTAGATCCTGTGCGAAGGATTGTTTCTCTGCGTACGAGAAAGACGAAAGCAAACTCGGTGGAAGGATGGTATTGTCGTGGTCTAAAGATAAGTCACTG
  5   1   2       bld Oo1                             IMAGE:6640396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCGGAAAAGCGAATGTGTGGAGGGAGAGACACAGGGAATCATGAAGAGTTTAAAGTCCAGGCTGAAGAAACACGAAGTGACCATAACACAAACGGCTGACTGGAATAAATATGATGAACGGTTGATGAGAGCGGCAGAGAGGGGAGATGCAGAGAAAGTCTCATCCACACTTGCCAAGAAGGGTGTTAATCCCAGCAAACTTGACTTGGAGGGACACACAGCATTTCATGTTGTAGCTTCAAAGGGTCACCTGGAATGCCTGAATCTTATCCTGATACATGGGGTAGATCTCACAGCTCCAGATGCAGCAGGTAGAAACGCTCTGCATTTATCAGCAAAGTATGGCCACTCCTTGTGTCTGCAGAAATTGCTGCAGTTCAATTGCCCAACAGAGAATGTGGATCTGCAAGGCCGCACTGCTTTACATGATGCAGCCATGTCTGATTGCTGTTCCAGTGTACAGCTTCTCTGTGATCATGGGGCATCTGTTAATGCAAAAGATGGGGATGGAAGGACTCCCCTGGCTCTCTCGACCCAGATGTGTCGCCCTGCCATATGCCAACTTTTAATAGAAAAGGGAGCAGACATAAATTCCAGAGACAAGCAGAATAAGACCCCACTGATGCTGGGTTGTGAGTATGGCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGATTGTGCATATTACAGCAGGATTGGAAATAAACCTGGAGGTCCTGACCCTGATCAAACGGCCATGGAGAATTCCCCTCAAGTGCTAGATCCTGGTGCGAAAGATTGTTTCTCTGCGTACGAGAAAGACGAAGCAAACTCGGTGGAAGAATGGTAGTGTCGTGTCTAAGATAAGTCACTGGATCTGGAAGCTGAAATGAGAACCTACGGGAGGAGGCTT
  5   1   2       bld Gas8      out                   IMAGE:3518012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCACAACCCAGCATCAGTGGGGTCTTATTCTGTAAGGAGGCAGTGGATGTCTTATTAAGAGCTGGAGCTGATGTTAACTTGGTTGACTCCTTTGGTCATGATTGTGCATATTACACAGGATTGGAGATAACCTGGAGGTCCTGACCCTGATCAAAACGGCCATGGAGAATTCCCCTCAAGTGCTAGATCCTGTGCGAAGGATTGTTTCTCTGCGTACGAGAAAGACGAAGCAAAACTCGGTGGAAGATGGTAGTGTCGTGTCTAAAGATAAGTCACTGGATCTGGAAGCTGAAAATGAGAACCTACGGGAGAGGCTTCGGAAAATACAACATGAGCAGAGAACTCTCTTTGAGAAAGTGGAGGGATTACAACATCAACTCAGCCAATTGATGTCTGATGACCTAGAAAATGAGAAGAGCATCTGAAAGCAATTCTAGAAGGaaaagaaaaaaaaCTGGAAGAATGTCTAAGAACCATGGAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)